RAB13 (NM_001272038) Human Untagged Clone

CAT#: SC331025

RAB13 (untagged) - Homo sapiens RAB13, member RAS oncogene family (RAB13), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB13
• Synonyms: GIG4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001272038, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCATTATCCTAGTATACGACATCACGGATGAGAAATCTTTCGAGAATATTCAGAACTGGATGAAAA
  GCATCAAGGAGAATGCCTCGGCTGGGGTGGAGCGCCTCTTGCTGGGGAACAAATGTGACATGGAGGCCAA
  GAGGAAGGTGCAGAAGGAGCAGGCCGATAAGTTGGCTCGAGAGCATGGAATCCGATTTTTCGAAACTAGT
  GCTAAATCCAGTATGAATGTGGATGAGGCTTTTAGTTCCCTGGCCCGGGACATCTTGCTCAAGTCAGGAG
  GCCGGAGATCAGGAAACGGCAACAAGCCTCCCAGTACTGACCTGAAAACTTGTGACAAGAAGAACACCAA
  CAAGTGCTCCCTGGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272038
• ORF Size: 369 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001272038.1, NP_001258967.1
• RefSeq Size: 1353
• RefSeq ORF: 369
• Locus ID: 5872
• Protein Families: Druggable Genome
• Protein Pathways: Tight junction
• Gene Summary: This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (2) contains a novel 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.