RAB13 (NM_001272038) Human Untagged Clone
CAT#: SC331025
RAB13 (untagged) - Homo sapiens RAB13, member RAS oncogene family (RAB13), transcript variant 2
"NM_001272038" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "RAB13"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB13 |
Synonyms | GIG4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001272038, the custom clone sequence may differ by one or more nucleotides
ATGGGCATTATCCTAGTATACGACATCACGGATGAGAAATCTTTCGAGAATATTCAGAACTGGATGAAAA GCATCAAGGAGAATGCCTCGGCTGGGGTGGAGCGCCTCTTGCTGGGGAACAAATGTGACATGGAGGCCAA GAGGAAGGTGCAGAAGGAGCAGGCCGATAAGTTGGCTCGAGAGCATGGAATCCGATTTTTCGAAACTAGT GCTAAATCCAGTATGAATGTGGATGAGGCTTTTAGTTCCCTGGCCCGGGACATCTTGCTCAAGTCAGGAG GCCGGAGATCAGGAAACGGCAACAAGCCTCCCAGTACTGACCTGAAAACTTGTGACAAGAAGAACACCAA CAAGTGCTCCCTGGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272038 |
ORF Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001272038.1, NP_001258967.1 |
RefSeq Size | 1353 |
RefSeq ORF | 369 |
Locus ID | 5872 |
Protein Families | Druggable Genome |
Protein Pathways | Tight junction |
Gene Summary | This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (2) contains a novel 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.