S6K1 (RPS6KB1) (NM_001272042) Human Untagged Clone

CAT#: SC331026

RPS6KB1 (untagged) - Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), transcript variant 2


  "NM_001272042" in other vectors (2)

Reconstitution Protocol

USD 500.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RPS6KB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPS6KB1
Synonyms p70 S6KA; p70(S6K)-alpha; p70-alpha; p70-S6K; PS6K; S6K; S6K-beta-1; S6K1; STK14A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001272042, the custom clone sequence may differ by one or more nucleotides


ATGAGGCGACGAAGGAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGACA
TGGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCTGAGGATGAGCTGGAGGAGGG
GGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCATATGAACTTGGCATGGAACATTGTGAG
AAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAGCTAC
TTCGGGTACTTGGTAAAGGGGGCTATGGAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCTCATAC
AAAAGCAGAACGGAATATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTATGCCTTTCAG
ACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAG
AGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACA
TCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAA
CTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAA
TAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGG
AGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGAC
AAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACACAAGAAGCCAGAGATCTGCTTAAAAAGC
TGCTGAAAAGAAATGCTGCTTCTCGTCTGGGAGCTGGTCCTGGGGACGCTGGAGAAGTTCAAGCTCATCC
ATTCTTTAGACACATTAACTGGGAAGAACTTCTGGCTCGAAAGGTGGAGCCCCCCTTTAAACCTCTGTTG
CAATCTGAAGAGGATGTAAGTCAGTTTGATTCCAAGTTTACACGTCAGACACCTGTCGACAGCCCAGATG
ACTCAACTCTCAGTGAAAGTGCCAATCAGGTCTTTCTGGGTTTTACATATGTGGCTCCATCTGTACTTGA
AAGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGATTTATTGGCAGCCCACGA
ACACCTGTCAGCCCAGTCAAATTTTCTCCTGGGGATTTCTGGGGAAGAGGTGCTTCGGCCAGCACAGCAA
ATCCTCAGACACCTGTGGAATACCCAATGGAAACAAGTGGCATAGAGCAGATGGATGTGACAATGAGTGG
GGAAGCATCGGCACCACTTCCAATACGACAGCCGAACTCTGGGCCATACAAAAAACAAGCTTTTCCCATG
ATCTCCAAACGGCCAGAGCACCTGCGTATGAATCTATGA


Restriction Sites SgfI-MluI     
ACCN NM_001272042
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272042.1, NP_001258971.1
RefSeq Size 5299 bp
RefSeq ORF 1509 bp
Locus ID 6198
Cytogenetics 17q23.1
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Acute myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway
Gene Summary 'This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]'
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1. This variant can initiate translation from two alternate in-frame AUG start codons. The isoform represented in this RefSeq (b) is derived from the first AUG start codon, and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.