S6K1 (RPS6KB1) (NM_001272042) Human Untagged Clone
CAT#: SC331026
RPS6KB1 (untagged) - Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), transcript variant 2
"NM_001272042" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RPS6KB1 |
Synonyms | p70 S6KA; p70(S6K)-alpha; p70-alpha; p70-S6K; PS6K; S6K; S6K-beta-1; S6K1; STK14A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001272042, the custom clone sequence may differ by one or more nucleotides
ATGAGGCGACGAAGGAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGACA TGGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCTGAGGATGAGCTGGAGGAGGG GGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCATATGAACTTGGCATGGAACATTGTGAG AAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAGCTAC TTCGGGTACTTGGTAAAGGGGGCTATGGAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCTCATAC AAAAGCAGAACGGAATATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTATGCCTTTCAG ACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAG AGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACA TCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAA CTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAA TAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGG AGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGAC AAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACACAAGAAGCCAGAGATCTGCTTAAAAAGC TGCTGAAAAGAAATGCTGCTTCTCGTCTGGGAGCTGGTCCTGGGGACGCTGGAGAAGTTCAAGCTCATCC ATTCTTTAGACACATTAACTGGGAAGAACTTCTGGCTCGAAAGGTGGAGCCCCCCTTTAAACCTCTGTTG CAATCTGAAGAGGATGTAAGTCAGTTTGATTCCAAGTTTACACGTCAGACACCTGTCGACAGCCCAGATG ACTCAACTCTCAGTGAAAGTGCCAATCAGGTCTTTCTGGGTTTTACATATGTGGCTCCATCTGTACTTGA AAGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGATTTATTGGCAGCCCACGA ACACCTGTCAGCCCAGTCAAATTTTCTCCTGGGGATTTCTGGGGAAGAGGTGCTTCGGCCAGCACAGCAA ATCCTCAGACACCTGTGGAATACCCAATGGAAACAAGTGGCATAGAGCAGATGGATGTGACAATGAGTGG GGAAGCATCGGCACCACTTCCAATACGACAGCCGAACTCTGGGCCATACAAAAAACAAGCTTTTCCCATG ATCTCCAAACGGCCAGAGCACCTGCGTATGAATCTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272042 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001272042.1, NP_001258971.1 |
RefSeq Size | 5299 bp |
RefSeq ORF | 1509 bp |
Locus ID | 6198 |
Cytogenetics | 17q23.1 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Acute myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway |
Gene Summary | 'This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]' Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1. This variant can initiate translation from two alternate in-frame AUG start codons. The isoform represented in this RefSeq (b) is derived from the first AUG start codon, and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232878 | RPS6KB1 (Myc-DDK tagged) - Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), transcript variant 2 |
USD 480.00 |
|
RG232878 | RPS6KB1 (GFP-tagged) - Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), transcript variant 2 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review