Thymidine Kinase 2 (TK2) (NM_001272050) Human Untagged Clone
CAT#: SC331029
TK2 (untagged) - Homo sapiens thymidine kinase 2, mitochondrial (TK2), transcript variant 9
"NM_001272050" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "TK2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TK2 |
Synonyms | MTDPS2; MTTK; PEOB3; SCA31 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001272050, the custom clone sequence may differ by one or more nucleotides
ATGTACCACGATGCCTCTCGCTGGGGTCTTACGCTACAGACTTATGTGCAGCTCACCATGCTGGACAGGC ATACTCGTCCTCAGGTGTCATCTGTACGGTTGATGGAGAGGTCGATTCACAGCGCAAGATACATTTTTGT AGAAAACCTGTATAGAAGTGGGAAGATGCCAGAAGTGGACTATGTAGTTCTGTCGGAATGGTTTGACTGG ATCTTGAGGAACATGGACGTGTCTGTTGATTTGATAGTTTACCTTCGGACCAATCCTGAGACTTGTTACC AGAGGTTAAAGAAGAGATGCAGGGAAGAGGAGAAGGTCATTCCGCTGGAATACCTGGAAGCAATTCACCA TCTCCATGAGGAGTGGCTCATCAAAGGCAGCCTTTTCCCCATGGCAGCCCCTGTTCTGGTGATTGAGGCT GACCACCACATGGAGAGGATGTTAGAACTCTTTGAACAAAATCGGGATCGAATATTAACTCCAGAGAATC GGAAGCATTGCCCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272050 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001272050.1, NP_001258979.1 |
RefSeq Size | 4907 bp |
RefSeq ORF | 507 bp |
Locus ID | 7084 |
Cytogenetics | 16q21 |
Protein Families | Druggable Genome |
Protein Pathways | Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism |
Gene Summary | 'This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012]' Transcript Variant: This variant (9) contains an alternate 5' exon and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (7) has a shorter N-terminus, compared to isoform 1, but is predicted to be a mitochondrial protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.