YOD1 (NM_001276320) Human Untagged Clone

CAT#: SC331043

YOD1 (untagged) - Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2


  "NM_001276320" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "YOD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol YOD1
Synonyms DUBA8; OTUD2; PRO0907
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276320, the custom clone sequence may differ by one or more nucleotides


ATGGAAACATTACATATAATTTATTCAGAAGCAAAGTCTTTTACAGTGGAGGGGCTGTCCAGCCGGACCC
GGGTGCGGGAACTCCAGGGCCAAATTGCCGCCATCACCGGGATCGCCCCCGGCGGTCAGCGAATCCTCGT
CGGATACCCTCCCGAGTGCCTGGATCTCAGCAATGGGGATACCATTCTGGAAGACTTGCCCATCCAATCT
GGTGACATGCTGATCATTGAAGAAGACCAAACCAGGCCCAGAAGTTCACCTGCATTTACTAAACGTGGTG
CTTCTAGTTACGTCAGGGAAACTTTGCCTGTGCTTACCAGAACCGTGGTCCCAGCAGACAACTCTTGCCT
CTTTACTAGTGTGTACTATGTCGTCGAAGGAGGAGTCTTGAATCCAGCTTGTGCCCCTGAGATGAGACGC
CTCATAGCACAAATTGTAGCAAGCGATCCAGACTTCTATAGTGAGGCAATACTGGGAAAAACAAATCAAG
AGTACTGTGACTGGATCAAAAGGGATGACACTTGGGGAGGAGCAATAGAGATATCGATTTTGTCCAAGTT
TTACCAATGTGAAATATGTGTAGTGGATACACAGACAGTAAGAATTGATCGTTTTGGGGAAGATGCAGGA
TATACCAAAAGGGTTCTGCTTATTTATGATGGCATCCACTATGATCCACTTCAGCGTAACTTCCCTGATC
CAGATACACCTCCTCTGACCATTTTCTCCTCTAATGATGATATTGTTCTTGTACAAGCACTGGAATTAGC
AGATGAAGCTAGAAGAAGGAGACAGTTTACTGATGTCAACCGCTTCACCCTGAGATGCATGGTATGTCAG
AAAGGATTAACTGGACAAGCAGAAGCAAGGGAACATGCCAAGGAGACAGGCCATACCAACTTTGGAGAAG
TGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001276320
ORF Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001276320.1, NP_001263249.1
RefSeq Size 6291
RefSeq ORF 915
Locus ID 55432
Protein Pathways Biosynthesis of unsaturated fatty acids, Limonene and pinene degradation
Gene Summary Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) contains alternate exons in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.