YOD1 (NM_001276320) Human Untagged Clone

CAT#: SC331043

YOD1 (untagged) - Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: YOD1
• Synonyms: DUBA8; OTUD2; PRO0907
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276320, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAACATTACATATAATTTATTCAGAAGCAAAGTCTTTTACAGTGGAGGGGCTGTCCAGCCGGACCC
  GGGTGCGGGAACTCCAGGGCCAAATTGCCGCCATCACCGGGATCGCCCCCGGCGGTCAGCGAATCCTCGT
  CGGATACCCTCCCGAGTGCCTGGATCTCAGCAATGGGGATACCATTCTGGAAGACTTGCCCATCCAATCT
  GGTGACATGCTGATCATTGAAGAAGACCAAACCAGGCCCAGAAGTTCACCTGCATTTACTAAACGTGGTG
  CTTCTAGTTACGTCAGGGAAACTTTGCCTGTGCTTACCAGAACCGTGGTCCCAGCAGACAACTCTTGCCT
  CTTTACTAGTGTGTACTATGTCGTCGAAGGAGGAGTCTTGAATCCAGCTTGTGCCCCTGAGATGAGACGC
  CTCATAGCACAAATTGTAGCAAGCGATCCAGACTTCTATAGTGAGGCAATACTGGGAAAAACAAATCAAG
  AGTACTGTGACTGGATCAAAAGGGATGACACTTGGGGAGGAGCAATAGAGATATCGATTTTGTCCAAGTT
  TTACCAATGTGAAATATGTGTAGTGGATACACAGACAGTAAGAATTGATCGTTTTGGGGAAGATGCAGGA
  TATACCAAAAGGGTTCTGCTTATTTATGATGGCATCCACTATGATCCACTTCAGCGTAACTTCCCTGATC
  CAGATACACCTCCTCTGACCATTTTCTCCTCTAATGATGATATTGTTCTTGTACAAGCACTGGAATTAGC
  AGATGAAGCTAGAAGAAGGAGACAGTTTACTGATGTCAACCGCTTCACCCTGAGATGCATGGTATGTCAG
  AAAGGATTAACTGGACAAGCAGAAGCAAGGGAACATGCCAAGGAGACAGGCCATACCAACTTTGGAGAAG
  TGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276320
• ORF Size: 915 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001276320.1, NP_001263249.1
• RefSeq Size: 6291
• RefSeq ORF: 915
• Locus ID: 55432
• Protein Pathways: Biosynthesis of unsaturated fatty acids, Limonene and pinene degradation
• Gene Summary: Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (2) contains alternate exons in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.