KCNJ15 (NM_001276435) Human Untagged Clone
CAT#: SC331055
KCNJ15 (untagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 4
"NM_001276435" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNJ15 |
Synonyms | IRKK; KIR1.3; KIR4.2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001276435, the custom clone sequence may differ by one or more nucleotides
ATGGATGCCATTCACATCGGCATGTCCAGCACCCCCCTGGTGAAGCACACTGCTGGGGCTGGGCTCAAGG CCAACAGACCCCGCGTCATGTCCAAGAGTGGGCACAGCAACGTGAGAATTGACAAAGTGGATGGCATATA CCTACTCTACCTGCAAGACCTGTGGACCACAGTTATCGACATGAAGTGGAGATACAAACTCACCCTGTTC GCTGCCACTTTTGTGATGACCTGGTTCCTTTTTGGAGTCATCTACTATGCCATCGCGTTTATTCATGGGG ACTTAGAACCCGGTGAGCCCATTTCAAATCATACCCCCTGCATCATGAAAGTGGACTCTCTCACTGGGGC GTTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCGTTCCATCACAGAGGAATGTCCT CATGCCATCTTCCTGTTGGTTGCTCAGTTGGTCATCACGACCTTGATTGAGATCTTCATCACCGGAACCT TCCTGGCCAAAATCGCCAGACCCAAAAAGCGGGCTGAGACCATCAAGTTCAGCCACTGTGCAGTCATCAC CAAGCAGAATGGGAAGCTGTGCTTGGTGATTCAGGTAGCCAATATGAGGAAGAGCCTCTTGATTCAGTGC CAGCTCTCTGGCAAGCTCCTGCAGACCCACGTCACCAAGGAGGGGGAGCGGATTCTCCTCAACCAAGCCA CTGTCAAATTCCACGTGGACTCCTCCTCTGAGAGCCCCTTCCTCATTCTGCCCATGACATTCTACCATGT GCTGGATGAGACGAGCCCCCTGAGAGACCTCACACCCCAAAACCTAAAGGAGAAGGAGTTTGAGCTTGTG GTCCTCCTCAATGCCACTGTGGAATCCACCAGCGCTGTCTGCCAGAGCCGAACATCTTATATCCCAGAGG AAATCTACTGGGGTTTTGAGTTTGTGCCTGTGGTATCTCTCTCCAAAAATGGAAAATATGTGGCTGATTT CAGTCAGTTTGAACAGATTCGGAAAAGCCCAGATTGCACATTTTACTGTGCAGATTCTGAGAAACAGCAA CTCGAGGAGAAGTACAGGCAGGAGGATCAGAGGGAAAGAGAACTGAGGACACTTTTATTACAACAGAGCA ATGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276435 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276435.1, NP_001263364.1 |
RefSeq Size | 3081 bp |
RefSeq ORF | 1128 bp |
Locus ID | 3772 |
Cytogenetics | 21q22.13-q22.2 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]' Transcript Variant: This variant (4) uses an alternate splice junction and contains two additional exons in the 5' UTR compared to variant 1. All eight variants encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232608 | KCNJ15 (Myc-DDK tagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 4 |
USD 420.00 |
|
RG232608 | KCNJ15 (GFP-tagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review