SDHD (NM_001276503) Human Untagged Clone

CAT#: SC331066

SDHD (untagged) - Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD), transcript variant 2


  "NM_001276503" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SDHD"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SDHD
Synonyms CBT1; CII-4; CWS3; cybS; PGL; PGL1; QPs3; SDH4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276503, the custom clone sequence may differ by one or more nucleotides


ATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCGAGCTCTGTTGCTTCGAACTC
CAGTGGTCAGACCTGCTCATATCTCAGCATTTCTTCAGGACCGACCTATCCCAGAATGGTGTGGAGTGCA
GCACATACACTTGTCACCGAGCCACCATTGGGCCTTGGACAAGTTGTTACTGACTATGTTCATGGGGATG
CCTTGCAGAAAGCTGCCAAGGCAGGGCTTTTGGCACTTTCAGCTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001276503
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276503.1, NP_001263432.1
RefSeq Size 1250 bp
RefSeq ORF 258 bp
Locus ID 6392
Cytogenetics 11q23.1
Protein Pathways Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary 'This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]'
Transcript Variant: This variant (2) lacks an alternate coding exon, which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.