Kallikrein 15 (KLK15) (NM_001277081) Human Untagged Clone
CAT#: SC331084
KLK15 (untagged) - Homo sapiens kallikrein-related peptidase 15 (KLK15), transcript variant 5
"NM_001277081" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "KLK15"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLK15 |
Synonyms | ACO; HSRNASPH |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001277081, the custom clone sequence may differ by one or more nucleotides
ATGTGGCTTCTCCTCACTCTCTCCTTCCTGCTGGCATCCACAGCCCAGGATGGTGACAAGTTGCTGGAAG GTGACGAGTGTGCACCCCACTCCCAGCCATGGCAAGTGGCTCTCTACGAGCGTGGACGCTTTAACTGTGG CGCTTCCCTCATCTCCCCACACTGGGTGCTGTCTGCGGCCCACTGCCAAAGCCGCTTCATGAGAGTGCGC CTGGGAGAGCACAACCTGCGCAAGCGCGATGGCCCAGAGCAACTACGGACCACGTCTCGGGTCATTCCAC ACCCGCGCTACGAAGCGCGCAGCCACCGCAACGACATCATGTTGCTGCGCCTAGTCCAGCCCGCACGCCT GAACCCCCAGGTGCGCCCCGCGGTGCTACCCACGCGTTGCCCCCACCCGGGGGAGGCCTGTGTGGTGTCT GGCTGGGGCCTGGTGTCCCACAACGAGCCTGGGACCGCTGGGAGCCCCCGGTCACAAGTGAGTCTCCCAG ATACGTTGCATTGTGCCAACATCAGCATTATCTCGGACACATCTTGTGACAAGAGCTACCCAGGGCGCCT GACAAACACCATGGTGTGTGCAGGCGCGGAGGGCAGAGGCGCAGAATCCTGTGAGGGTGACTCTGGGGGA CCCCTGGTCTGTGGGGGCATCCTGCAGGGCATTGTGTCCTGGGGTGACGTCCCTTGTGACAACACCACCA AGCCTGGTGTCTATACCAAAGTCTGCCACTACTTGGAGTGGATCAGGGAAACCATGAAGAGGAACTGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001277081 |
ORF Size | 768 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001277081.1, NP_001264010.1 |
RefSeq Size | 1322 |
RefSeq ORF | 768 |
Locus ID | 55554 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, compared to variant 4, resulting in an isoform (5) that is 1 aa shorter than isoform 4. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.