Kallikrein 15 (KLK15) (NM_001277081) Human Untagged Clone

CAT#: SC331084

KLK15 (untagged) - Homo sapiens kallikrein-related peptidase 15 (KLK15), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLK15
• Synonyms: ACO; HSRNASPH
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001277081, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGCTTCTCCTCACTCTCTCCTTCCTGCTGGCATCCACAGCCCAGGATGGTGACAAGTTGCTGGAAG
  GTGACGAGTGTGCACCCCACTCCCAGCCATGGCAAGTGGCTCTCTACGAGCGTGGACGCTTTAACTGTGG
  CGCTTCCCTCATCTCCCCACACTGGGTGCTGTCTGCGGCCCACTGCCAAAGCCGCTTCATGAGAGTGCGC
  CTGGGAGAGCACAACCTGCGCAAGCGCGATGGCCCAGAGCAACTACGGACCACGTCTCGGGTCATTCCAC
  ACCCGCGCTACGAAGCGCGCAGCCACCGCAACGACATCATGTTGCTGCGCCTAGTCCAGCCCGCACGCCT
  GAACCCCCAGGTGCGCCCCGCGGTGCTACCCACGCGTTGCCCCCACCCGGGGGAGGCCTGTGTGGTGTCT
  GGCTGGGGCCTGGTGTCCCACAACGAGCCTGGGACCGCTGGGAGCCCCCGGTCACAAGTGAGTCTCCCAG
  ATACGTTGCATTGTGCCAACATCAGCATTATCTCGGACACATCTTGTGACAAGAGCTACCCAGGGCGCCT
  GACAAACACCATGGTGTGTGCAGGCGCGGAGGGCAGAGGCGCAGAATCCTGTGAGGGTGACTCTGGGGGA
  CCCCTGGTCTGTGGGGGCATCCTGCAGGGCATTGTGTCCTGGGGTGACGTCCCTTGTGACAACACCACCA
  AGCCTGGTGTCTATACCAAAGTCTGCCACTACTTGGAGTGGATCAGGGAAACCATGAAGAGGAACTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001277081
• ORF Size: 768 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001277081.1, NP_001264010.1
• RefSeq Size: 1322
• RefSeq ORF: 768
• Locus ID: 55554
• Protein Families: Druggable Genome, Protease, Secreted Protein
• Gene Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, compared to variant 4, resulting in an isoform (5) that is 1 aa shorter than isoform 4.