MED8 (NM_001001653) Human Untagged Clone

CAT#: SC331121

MED8 (untagged) - Homo sapiens mediator complex subunit 8 (MED8), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MED8
• Synonyms: ARC32
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001001653, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGCAGACTGAAGGACGGGTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGAACCAAGC
  CTGACCCTGAAGTGGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGCATTGGTGCAGATGCAGC
  CCAGAAGCAGATCCAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAAGAGGAGCGA
  GAATCAGAGAGTGGAGGTCTCCGGCCGAACAAGCAGACCTTTAACCCTACAGACACTAATGCCTTGGTGG
  CAGCTGTTGCCTTTGGGAAAGGACTATCTAATTGGAGACCTTCAGGCAGCAGTGGTCCTGGCCAGGCAGG
  CCAGCCAGGAGCTGGGACGATCCTTGCAGGAACCTCAGGATTACAGCAGGTGCAGATGGCAGGAGCTCCA
  AGCCAGCAGCAGCCAATGCTCAGTGGGGTACAAATGGCTCAGGCAGGTCAACCAGGGAAAATGCCAAGTG
  GAATAAAAACCAACATCAAGTCGGCTTCCATGCATCCCTACCAGCGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001001653
• ORF Size: 540 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001001653.2, NP_001001653.1
• RefSeq Size: 2032
• RefSeq ORF: 540
• Locus ID: 112950
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a protein component of the mediator complex, which aids in transcriptional activation through interaction with RNA polymerase II and gene-specific transcription factors. The encoded protein may also function in ubiquitin ligation and protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (4) contains multiple differences in the UTRs and coding region, compared to variant 3. It initiates translation at a downstream in-frame start codon. The encoded isoform (1) has shorter N- and C-termini, compared to isoform 3.