ProDynorphin (PDYN) (NM_001190898) Human Untagged Clone
CAT#: SC331141
PDYN (untagged) - Homo sapiens prodynorphin (PDYN), transcript variant 2
"NM_001190898" in other vectors (2)
Product Images
Other products for "PDYN"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PDYN |
Synonyms | ADCA; PENKB; SCA23 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001190898, the custom clone sequence may differ by one or more nucleotides
ATGGCCTGGCAGGGGCTGGTCCTGGCTGCCTGCCTCCTCATGTTCCCCTCCACCACAGCGGACTGCCTGT CGCGGTGCTCCTTGTGTGCTGTAAAGACCCAGGATGGTCCCAAACCTATCAATCCCCTGATTTGCTCCCT GCAATGCCAGGCTGCCCTGCTGCCCTCTGAGGAATGGGAGAGATGCCAGAGCTTTCTGTCTTTTTTCACC CCCTCCACCCTTGGGCTCAATGACAAGGAGGACTTGGGGAGCAAGTCGGTTGGGGAAGGGCCCTACAGTG AGCTGGCCAAGCTCTCTGGGTCATTCCTGAAGGAGCTGGAGAAAAGCAAGTTTCTCCCAAGTATCTCAAC AAAGGAGAACACTCTGAGCAAGAGCCTGGAGGAGAAGCTCAGGGGTCTCTCTGACGGGTTTAGGGAGGGA GCAGAGTCTGAGCTGATGAGGGATGCCCAGCTGAACGATGGTGCCATGGAGACTGGCACACTCTATCTCG CTGAGGAGGACCCCAAGGAGCAGGTCAAACGCTATGGGGGCTTTTTGCGCAAATACCCCAAGAGGAGCTC AGAGGTGGCTGGGGAGGGGGACGGGGATAGCATGGGCCATGAGGACCTGTACAAACGCTATGGGGGCTTC TTGCGGCGCATTCGTCCCAAGCTCAAGTGGGACAACCAGAAGCGCTATGGCGGTTTTCTCCGGCGCCAGT TCAAGGTGGTGACTCGGTCTCAGGAAGATCCGAATGCTTACTCTGGAGAGCTTTTTGATGCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001190898 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001190898.2, NP_001177827.1 |
RefSeq Size | 2797 bp |
RefSeq ORF | 765 bp |
Locus ID | 5173 |
Cytogenetics | 20p13 |
Protein Families | Secreted Protein |
Gene Summary | 'The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]' Transcript Variant: This variant (2) has an alternate splice site in the 5' UTR, which results in three nt less than variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.