APOBEC3A_B (NM_001193289) Human Untagged Clone

CAT#: SC331152

APOBEC3A_B (untagged) - Homo sapiens APOBEC3A and APOBEC3B deletion hybrid (APOBEC3A_B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APOBEC3A_B
• Synonyms: A3A; APOBEC3A
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001193289, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGCCAGCCCAGCATCCGGGCCCAGACACTTGATGGATCCACACATATTCACTTCCAACTTTAACA
  ATGGCATTGGAAGGCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGACAATGGCACCTCGGTCAA
  GATGGACCAGCACAGGGGCTTTCTACACAACCAGGCTAAGAATCTTCTCTGTGGCTTTTACGGCCGCCAT
  GCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCCCAGATCTACAGGGTCACTT
  GGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAA
  CACACACGTGAGACTGCGTATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCACTG
  CAAATGCTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGATGAATTTAAGCACTGCTGGGACA
  CCTTTGTGGACCACCAGGGATGTCCCTTCCAGCCCTGGGATGGACTAGATGAGCACAGCCAAGCCCTGAG
  TGGGAGGCTGCGGGCCATTCTCCAGAATCAGGGAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193289
• ORF Size: 600 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001193289.1, NP_001180218.1
• RefSeq Size: 1103
• RefSeq ORF: 600
• Locus ID: 100913187
• Gene Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. The protein encoded by this gene is the same as that encoded by APOBEC3A; however, this gene is a hybrid gene that results from the deletion of approximately 29.5 kb of sequence between the APOBEC3A gene and the adjacent gene APOBEC3B. The breakpoints of the deletion are within the two genes, so the deletion hybrid is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. [provided by RefSeq, Jul 2012]