Aminoacylase 1 (ACY1) (NM_001198895) Human Untagged Clone

CAT#: SC331233

ACY1 (untagged) - Homo sapiens aminoacylase 1 (ACY1), transcript variant 2


  "NM_001198895" in other vectors (2)

Reconstitution Protocol

USD 410.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACY1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACY1
Synonyms ACY-1; ACY1D; HEL-S-5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001198895, the custom clone sequence may differ by one or more nucleotides


ATGACCAGCAAGGGTCCCGAGGAGGAGCACCCATCGGTGACGCTCTTCCGCCAGTACCTGCGTATCCGCA
CTGTCCAGCCCAAGCCTGACTATGGAGCTGCTGTGGCTTTCTTTGAGGAGACAGCCCGCCAGCTGGGCCT
GGGCTGTCAGAAAGTAGAGGTGGCACCTGGCTATGTGGTGACCGTGTTGACCTGGCCAGGCACCAACCCT
ACACTCTCCTCCATCTTGCTCAACTCCCACACGGATGTGGTGCCTGTCTTCAAGGAACATTGGAGTCACG
ACCCCTTTGAGGCCTTCAAGGATTCTGAGGGCTACATCTATGCCAGGGGTGCCCAGGACATGAAGTGCGT
CAGCATCCAGTACCTGGAAGCTGTGAGGAGGCTGAAGGTGGAGGGCCACCGGTTCCCCAGAACCATCCAC
ATGACCTTTGTGCCTGATGAGGAGGTTGGGGGTCACCAAGGCATGGAGCTGTTCGTGCAGCGGCCTGAGT
TCCACGCCCTGAGGGCAGGCTTTGCCCTGGATGAGGGCATAGCCAATCCCACTGATGCCTTCACTGTCTT
TTATAGTGAGCGGAGTCCCTGGTGGGTGCGGGTTACCAGCACTGGGAGGCCAGGCCATGCCTCACGCTTC
ATGGAGGACACAGCAGCAGAGAAGCTGCACAAGGTTGTAAACTCCATCCTGGCATTCCGGGAGAAGGAAT
GGCAGAGGCTGCAGTCAAACCCCCACCTGAAAGAGGGGTCCGTGACCTCCGTGAACCTGACTAAGCTAGA
GGGTGGCGTGGCCTATAACGTGATACCTGCCACCATGAGCGCCAGCTTTGACTTCCGTGTGGCACCGGAT
GTGGACTTCAAGGCTTTTGAGGAGCAGCTGCAGAGCTGGTGCCAGGCAGCTGGCGAGGGGGTCACCCTAG
AGTTTGCTCAGAAGTGGATGCACCCCCAAGTGACACCTACTGATGACTCAAACCCTTGGTGGGCAGCTTT
TAGCCGGGTCTGCAAGGATATGAACCTCACTCTGGAGCCTGAGATCATGCCTGCTGCCACTGACAACCGC
TATATCCGCGCGGTGGGGGTCCCAGCTCTAGGCTTCTCACCCATGAACCGCACACCTGTGCTGCTGCACG
ACCACGATGAACGGCTGCATGAGGCTGTGTTCCTCCGTGGGGTGGACATATATACACGCCTGCTGCCTGC
CCTTGCCAGTGTGCCTGCCCTGCCCAGTGACAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001198895
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001198895.1, NP_001185824.1
RefSeq Size 1673 bp
RefSeq ORF 1227 bp
Locus ID 95
Cytogenetics 3p21.2
Protein Families Protease
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Gene Summary 'This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]'
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.