Shugoshin (SGO1) (NM_001199257) Human Untagged Clone

CAT#: SC331280

SGOL1 (untagged) - Homo sapiens shugoshin-like 1 (S. pombe) (SGOL1), transcript variant D1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SGO1
• Synonyms: CAID; NY-BR-85; SGO; SGOL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199257, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAAGGAAAGATGCCTGAAAAAGTCCTTTCAAGATAGTCTTGAAGACATAAAGAAGCGAATGAAAG
  AGAAAAGGAATAAAAACTTGGCAGAGATTGGCAAACGCAGGTCTTTTATAGCTGCACCATGCCAAATAAT
  CACCAACACTTCTACACTGCTGAAAAATTACCAAGACAACAACAAAATGTTAGTTTTAGCTTTGGAAAAT
  GAAAAATCCAAAGTGAAAGAAGCCCAAGATATCATCCTACAGCTGAGAAAAGAATGTTACTATCTCACAT
  GTCAGCTATATGCATTGAAAGGAAAACTTACATCACAACAAACAGTAGAACCTGCTCAGAACCAGGAAAT
  ATGTTCCTCTGGAATGGACCCCAATAGTGATGACAGCTCCAGAAATTTATTTGTGAAGGATTTACCGCAA
  ATTCCTCTTGAAGAAACTGAACTTCCAGGACAAGGAGAATCATTTCAAATAGAAGATCAGATACCTACTA
  TTCCTCAAGACACACTGGGAGTTGATTTTGATTCAGGAGCCCTGGAGGTATCACCTGCCAAAGAAGCAAT
  TTTTATTTTATATTATGTTCGAGAATTTGTTTCGAGATTCCCAGACTGTAGGAAATGTAAACTTGAAACC
  CACATCTGCTTGAGGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199257
• ORF Size: 648 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199257.1, NP_001186186.1
• RefSeq Size: 1454
• RefSeq ORF: 648
• Locus ID: 151648
• Protein Pathways: Oocyte meiosis
• Gene Summary: The protein encoded by this gene is a member of the shugoshin family of proteins. This protein is thought to protect centromeric cohesin from cleavage during mitotic prophase by preventing phosphorylation of a cohesin subunit. Reduced expression of this gene leads to the premature loss of centromeric cohesion, mis-segregation of sister chromatids, and mitotic arrest. Evidence suggests that this protein also protects a small subset of cohesin found along the length of the chromosome arms during mitotic prophase. An isoform lacking exon 6 has been shown to play a role in the cohesion of centrioles (PMID: 16582621 and PMID:18331714). Mutations in this gene have been associated with Chronic Atrial and Intestinal Dysrhythmia (CAID) syndrome, characterized by the co-occurrence of Sick Sinus Syndrome (SSS) and Chronic Intestinal Pseudo-obstruction (CIPO) within the first four decades of life (PMID:25282101). Fibroblast cells from CAID patients exhibited both increased cell proliferation and higher rates of senescence. Pseudogenes of this gene have been found on chromosomes 1 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (Sgo1J, PMID:15737064) uses an alternate splice site in its 3' coding region, lacks two exons in the 3' coding region, and contains an alternate 3' terminal exon compared to variant 1, resulting in a novel 3' coding region and distinct 3' UTR. It encodes isoform 1J which is shorter and has a distinct C-terminus, compared to isoform 1.