TRAF3 (NM_001199427) Human Untagged Clone

CAT#: SC331313

TRAF3 (untagged) - Homo sapiens TNF receptor-associated factor 3 (TRAF3), transcript variant 4


  "NM_001199427" in other vectors (2)

Reconstitution Protocol

USD 490.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TRAF3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRAF3
Synonyms CAP-1; CAP1; CD40bp; CRAF1; IIAE5; LAP1; RNF118
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199427, the custom clone sequence may differ by one or more nucleotides


ATGGAGTCGAGTAAAAAGATGGACTCTCCTGGCGCGCTGCAGACTAACCCGCCGCTAAAGCTGCACACTG
ACCGCAGTGCTGGGACGCCAGTTTTTGTCCCTGAACAAGGAGGTTACAAGGAAAAGTTTGTGAAGACCGT
GGAGGACAAGTACAAGTGTGAGAAGTGCCACCTGGTGCTGTGCAGCCCGAAGCAGACCGAGTGTGGGCAC
CGCTTCTGCGAGAGCTGCATGGCGGCCCTGCTGAGCTCTTCAAGTCCAAAATGTACAGCGTGTCAAGAGA
GCATCGTTAAAGATAAGGTGTTTAAGGATAATTGCTGCAAGAGAGAAATTCTGGCTCTTCAGATCTATTG
TCGGAATGAAAGCAGAGGTTGTGCAGAGCAGTTAATGCTGGGACATCTGCTGGTGCATTTAAAAAATGAT
TGCCATTTTGAAGAACTTCCATGTGTGCGTCCTGACTGCAAAGAAAAGGTCTTGAGGAAAGACCTGCGAG
ACCACGTGGAGAAGGCGTGTAAATACCGGGAAGCCACATGCAGCCACTGCAAGAGTCAGGTTCCGATGAT
CGCGCTGCAGGTTTCCTTGTTGCAGAATGAAAGTGTAGAAAAAAACAAGAGCATACAAAGTTTGCACAAT
CAGATATGTAGCTTTGAAATTGAAATTGAGAGACAAAAGGAAATGCTTCGAAATAATGAATCCAAAATCC
TTCATTTACAGCGAGTGATAGACAGCCAAGCAGAGAAACTGAAGGAGCTTGACAAGGAGATCCGGCCCTT
CCGGCAGAACTGGGAGGAAGCAGACAGCATGAAGAGCAGCGTGGAGTCCCTCCAGAACCGCGTGACCGAG
CTGGAGAGCGTGGACAAGAGCGCGGGGCAAGTGGCTCGGAACACAGGCCTGCTGGAGTCCCAGCTGAGCC
GGCATGACCAGATGCTGAGTGTGCACGACATCCGCCTAGCCGACATGGACCTGCGCTTCCAGGTCCTGGA
GACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTC
ATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGCTATAAGATGTGTGCCA
GGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTTTTTGTCATCATGCGTGG
AGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATGCTGATGGATCAGGGGTCC
TCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAG
AGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGTTCTAGAAAATGGGACATATATTAA
AGATGATACAATTTTTATTAAAGTCATAGTGGATACTTCGGATCTGCCCGATCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001199427
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199427.1, NP_001186356.1
RefSeq Size 7405 bp
RefSeq ORF 1458 bp
Locus ID 7187
Cytogenetics 14q32.32
Protein Families Druggable Genome
Protein Pathways Pathways in cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, Toll-like receptor signaling pathway
Gene Summary 'The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. The protein also plays a role in the regulation of antiviral response. Mutations in this are associated with Encephalopathy, acute, infection-induced, herpes-specific 5. [provided by RefSeq, Jul 2020]'
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame coding segment compared to variant 1. The resulting isoform (2) lacks an internal region as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.