NCR2 (NM_001199510) Human Untagged Clone

CAT#: SC331322

NCR2 (untagged) - Homo sapiens natural cytotoxicity triggering receptor 2 (NCR2), transcript variant 3


  "NM_001199510" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NCR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NCR2
Synonyms CD336; dJ149M18.1; LY95; NK-p44; NKP44
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199510, the custom clone sequence may differ by one or more nucleotides


ATGGCCTGGCGAGCCCTACACCCACTGCTACTGCTGCTGCTGCTGTTCCCAGGCTCTCAGGCACAATCCA
AGGCTCAGGTACTTCAAAGTGTGGCAGGGCAGACGCTAACCGTGAGATGCCAGTACCCGCCCACGGGCAG
TCTCTACGAGAAGAAAGGCTGGTGTAAGGAGGCTTCAGCACTTGTGTGCATCAGGTTAGTCACCAGCTCC
AAGCCCAGGACGATGGCTTGGACCTCTCGATTCACAATCTGGGACGACCCTGATGCTGGCTTCTTCACTG
TCACCATGACTGATCTGAGAGAGGAAGACTCAGGACATTACTGGTGTAGAATCTACCGCCCTTCTGACAA
CTCTGTCTCTAAGTCCGTCAGATTCTATCTGGTGGTATCTCCAGCCTCTGCCTCCACACAGACCTCCTGG
ACTCCCCGCGACCTGGTCTCTTCACAGACCCAGACCCAGAGCTGTGTGCCTCCCACTGCAGGAGCCAGAC
AAGCCCCTGAGTCTCCATCTACCATCCCTGTCCCTTCACAGCCACAGAACTCCACGCTCCGCCCTGGCCC
TGCAGCCCCCATTGCCCTGGTGCCTGTGTTCTGTGGACTCCTCGTAGCCAAGAGCCTGGTGCTGTCAGCC
CTGCTCGTCTGGTGGGTTTTAAGGAATCGGCACATGCAGCATCAAGGGAGGTCTCTGCTGCACCCAGCTC
AGCCCAGGCCCCAGGCCCATAGACACTTCCCACTGAGCCACAGGGCACCAGGGGGGACATATGGTGGAAA
ACCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001199510
ORF Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199510.1, NP_001186439.1
RefSeq Size 1048
RefSeq ORF 777
Locus ID 9436
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
Gene Summary Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has an additional exon which results in frame-shift, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.