Cathepsin S (CTSS) (NM_001199739) Human Untagged Clone

CAT#: SC331351

CTSS (untagged) - Homo sapiens cathepsin S (CTSS), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTSS
• Synonyms: FLJ50259; MGC3886
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199739, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACGGCTGGTTTGTGTGCTCTTGGTGTGCTCCTCTGCAGTGGCACAGTTGCATAAAGATCCTACCC
  TGGATCACCACTGGCATCTCTGGAAGAAAACCTATGGCAAACAATACAAGGAAAAGAATGAAGAAGCAGT
  ACGACGTCTCATCTGGGAAAAGAATCTAAAGTTTGTGATGCTTCACAACCTGGAGCATTCAATGGGAATG
  CACTCATACGATCTGGGCATGAACCACCTGGGAGACATGGGTTCTTGTGGTGCTTGCTGGGCTTTCAGTG
  CTGTGGGGGCCCTGGAAGCACAGCTGAAGCTGAAAACAGGAAAGCTGGTGTCTCTCAGTGCCCAGAACCT
  GGTGGATTGCTCAACTGAAAAATATGGAAACAAAGGCTGCAATGGTGGCTTCATGACAACGGCTTTCCAG
  TACATCATTGATAACAAGGGCATCGACTCAGACGCTTCCTATCCCTACAAAGCCATGGATCAGAAATGTC
  AATATGACTCAAAATATCGTGCTGCCACATGTTCAAAGTACACTGAACTTCCTTATGGCAGAGAAGATGT
  CCTGAAAGAAGCTGTGGCCAATAAAGGCCCAGTGTCTGTTGGTGTAGATGCGCGTCATCCTTCTTTCTTC
  CTCTACAGAAGTGGTGTCTACTATGAACCATCCTGTACTCAGAATGTGAATCATGGTGTACTTGTGGTTG
  GCTATGGTGATCTTAATGGGAAAGAATACTGGCTTGTGAAAAACAGCTGGGGCCACAACTTTGGTGAAGA
  AGGATATATTCGGATGGCAAGAAATAAAGGAAATCATTGTGGGATTGCTAGCTTTCCCTCTTACCCAGAA
  ATCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199739
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199739.1, NP_001186668.1
• RefSeq Size: 3957 bp
• RefSeq ORF: 846 bp
• Locus ID: 1520
• Cytogenetics: 1q21.3
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Antigen processing and presentation, Lysosome
• Gene Summary: 'The preproprotein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that participates in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. The mature protein cleaves the invariant chain of MHC class II molecules in endolysosomal compartments and enables the formation of antigen-MHC class II complexes and the proper display of extracellular antigenic peptides by MHC-II. The mature protein also functions as an elastase over a broad pH range. When secreted from cells, this protein can remodel components of the extracellular matrix such as elastin, collagen, and fibronectin. This gene is implicated in the pathology of many inflammatory and autoimmune diseases and, given its elastase activity, plays a significant role in some pulmonary diseases. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2020]'
  Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, so encodes a shorter isoform (2), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.