RDH5 (NM_001199771) Human Untagged Clone

CAT#: SC331359

RDH5 (untagged) - Homo sapiens retinol dehydrogenase 5 (11-cis/9-cis) (RDH5), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RDH5
• Synonyms: 9cRDH; HSD17B9; RDH1; SDR9C5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199771, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGCTGCCTCTTCTGCTGGGTGCCTTACTCTGGGCAGTGCTGTGGTTGCTCAGGGACCGGCAGAGCC
  TGCCCGCCAGCAATGCCTTTGTCTTCATCACCGGCTGTGACTCAGGCTTTGGGCGCCTTCTGGCACTGCA
  GCTGGACCAGAGAGGCTTCCGAGTCCTGGCCAGCTGCCTGACCCCCTCCGGGGCCGAGGACCTGCAGCGG
  GTGGCCTCCTCCCGCCTCCACACCACCCTGTTGGATATCACTGATCCCCAGAGCGTCCAGCAGGCAGCCA
  AGTGGGTGGAGATGCACGTTAAGGAAGCAGGGCTTTTTGGTCTGGTGAATAATGCTGGTGTGGCTGGTAT
  CATCGGACCCACACCATGGCTGACCCGGGACGATTTCCAGCGGGTGCTGAATGTGAACACAATGGGTCCC
  ATCGGGGTCACCCTTGCCCTGCTGCCTCTGCTGCAGCAAGCCCGGGGCCGGGTGATCAACATCACCAGCG
  TCCTGGGTCGCCTGGCAGCCAATGGTGGGGGCTACTGTGTCTCCAAATTTGGCCTGGAGGCCTTCTCTGA
  CAGCCTGAGGCGGGATGTAGCTCATTTTGGGATACGAGTCTCCATCGTGGAGCCTGGCTTCTTCCGAACC
  CCTGTGACCAACCTGGAGAGTCTGGAGAAAACCCTGCAGGCCTGCTGGGCACGGCTGCCTCCTGCCACAC
  AGGCCCACTATGGGGGGGCCTTCCTCACCAAGTACCTGAAAATGCAACAGCGCATCATGAACCTGATCTG
  TGACCCGGACCTAACCAAGGTGAGCCGATGCCTGGAGCATGCCCTGACTGCTCGACACCCCCGAACCCGC
  TACAGCCCAGGTTGGGATGCCAAGCTGCTCTGGCTGCCTGCCTCCTACCTGCCAGCCAGCCTGGTGGATG
  CTGTGCTCACCTGGGTCCTTCCCAAGCCTGCCCAAGCAGTCTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199771
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199771.1, NP_001186700.1
• RefSeq Size: 1359 bp
• RefSeq ORF: 957 bp
• Locus ID: 5959
• Cytogenetics: 12q13.2
• Protein Families: Druggable Genome
• Protein Pathways: Retinol metabolism
• Gene Summary: 'This gene encodes an enzyme belonging to the short-chain dehydrogenases/reductases (SDR) family. This retinol dehydrogenase functions to catalyze the final step in the biosynthesis of 11-cis retinaldehyde, which is the universal chromophore of visual pigments. Mutations in this gene cause autosomal recessive fundus albipunctatus, a rare form of night blindness that is characterized by a delay in the regeneration of cone and rod photopigments. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S1 (biogenesis of lysosomal organelles complex-1, subunit 1) gene. [provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.