B4GALT3 (NM_001199873) Human Untagged Clone

CAT#: SC331386

B4GALT3 (untagged) - Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 (B4GALT3), transcript variant 1


  "NM_001199873" in other vectors (2)

Reconstitution Protocol

USD 390.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "B4GALT3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B4GALT3
Synonyms beta4Gal-T3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199873, the custom clone sequence may differ by one or more nucleotides


ATGTTGCGGAGGCTGCTGGAGCGGCCTTGCACGCTGGCCCTGCTTGTGGGCTCCCAGCTGGCTGTCATGA
TGTACCTGTCACTGGGGGGCTTCCGAAGTCTCAGTGCCCTATTTGGCCGAGATCAGGGACCGACATTTGA
CTATTCTCACCCTCGTGATGTCTACAGTAACCTCAGTCACCTGCCTGGGGCCCCAGGGGGTCCTCCAGCT
CCTCAAGGTCTGCCCTACTGTCCAGAACGATCTCCTCTCTTAGTGGGTCCTGTGTCGGTGTCCTTTAGCC
CAGTGCCATCACTGGCAGAGATTGTGGAGCGGAATCCCCGGGTAGAACCAGGGGGCCGGTACCGCCCTGC
AGGTTGTGAGCCCCGCTCCCGAACAGCCATCATTGTGCCTCATCGTGCCCGGGAGCACCACCTGCGCCTG
CTGCTCTACCACCTGCACCCCTTCTTGCAGCGCCAGCAGCTTGCTTATGGCATCTATGTCATCCACCAGG
CTGGAAATGGAACATTTAACAGGGCAAAACTGTTGAACGTTGGGGTGCGAGAGGCCCTGCGTGATGAAGA
GTGGGACTGCCTGTTCTTGCACGATGTGGACCTCTTGCCAGAAAATGACCACAATCTGTATGTGTGTGAC
CCCCGGGGACCCCGCCATGTTGCCGTTGCTATGAACAAGTTTGGATACAGCCTCCCGTACCCCCAGTACT
TCGGAGGAGTCTCAGCACTTACTCCTGACCAGTACCTGAAGATGAATGGCTTCCCCAATGAATACTGGGG
CTGGGGTGGTGAGGATGACGACATTGCTACCAGGGTGCGCCTGGCTGGGATGAAGATCTCTCGGCCCCCC
ACATCTGTAGGACACTATAAGATGGTGAAGCACCGAGGAGATAAGGGCAATGAGGAAAATCCCCACAGAT
TTGACCTCCTGGTCCGTACCCAGAATTCCTGGACGCAAGATGGGATGAACTCACTGACATACCAGTTGCT
GGCTCGAGAGCTGGGGCCTCTTTATACCAACATCACAGCAGACATTGGGACTGACCCTCGGGGTCCTCGG
GCTCCTTCTGGGCCACGTTACCCACCTGGTTCCTCCCAAGCCTTCCGTCAAGAGATGCTGCAACGCCGGC
CCCCAGCCAGGCCTGGGCCTCTATCTACTGCCAACCACACAGCCCTCCGAGGTTCACACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001199873
ORF Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199873.1, NP_001186802.1
RefSeq Size 2438
RefSeq ORF 1182
Locus ID 8703
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways, N-Glycan biosynthesis
Gene Summary This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) is the longest transcript. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.