Dexras1 (RASD1) (NM_001199989) Human Untagged Clone

CAT#: SC331395

RASD1 (untagged) - Homo sapiens RAS, dexamethasone-induced 1 (RASD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RASD1
• Synonyms: AGS1; DEXRAS1; MGC:26290
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199989, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACTGGCCGCGATGATCAAGAAGATGTGCCCGAGCGACTCGGAGCTGAGTATCCCGGCCAAGAACT
  GCTATCGCATGGTCATCCTCGGCTCGTCCAAGGTGGGCAAGACGGCCATCGTGTCGCGCTTCCTCACCGG
  CCGCTTCGAGGACGCCTACACGCCTACCATCGAGGACTTCCACCGCAAGTTCTACTCCATCCGCGGCGAG
  GTCTACCAGCTCGACATCCTCGACACGTCCGGCAACCACCCGTTCCCCGCCATGCGGCGCCTCTCCATCC
  TCACAGATCCTCGACACCAAGTCTTGCCTCAAGAACAAAACCAAGGAGAACGTGGACGTGCCCCTGGTCA
  TCTGCGGCAACAAGGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199989
• ORF Size: 369 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199989.1, NP_001186918.1
• RefSeq Size: 1740
• RefSeq ORF: 369
• Locus ID: 51655
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the Ras superfamily of small GTPases and is induced by dexamethasone. The encoded protein is an activator of G-protein signaling and acts as a direct nucleotide exchange factor for Gi-Go proteins. This protein interacts with the neuronal nitric oxide adaptor protein CAPON, and a nuclear adaptor protein FE65, which interacts with the Alzheimer's disease amyloid precursor protein. This gene may play a role in dexamethasone-induced alterations in cell morphology, growth and cell-extracellular matrix interactions. Epigenetic inactivation of this gene is closely correlated with resistance to dexamethasone in multiple myeloma cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (2) has an alternate splice site in the CDS that results in a frame-shift compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.