FUS2 (NAT6) (NM_001200018) Human Untagged Clone

CAT#: SC331399

NAT6 (untagged) - Homo sapiens N-acetyltransferase 6 (GCN5-related) (NAT6), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NAT6
• Synonyms: FUS-2; FUS2; HsNAAA80; NAT6
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001200018, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCTGATCCTGAGTACCAGCCCAGCTGAGCTGACTCTGGATCCTGCGTGCCAGCCAAAGCTGCCCC
  TGGATTCCACATGCCAACCAGAGATGACCTTCAATCCTGGTCCAACTGAGCTTACCCTGGATCCTGAACA
  CCAGCCAGAGGAGACCCCAGCTCCTAGCCTGGCTGAGTTGACCCTGGAGCCTGTGCACCGCCGACCCGAG
  CTCCTGGATGCTTGTGCTGACCTCATCAATGATCAGTGGCCCCGCAGCCGCACCTCCCGCCTGCACTCCC
  TGGGCCAGTCCTCAGATGCCTTCCCCCTCTGCCTGATGCTGCTAAGCCCCCACCCCACACTTGAAGCAGC
  ACCCGTTGTGGTGGGCCATGCCCGCCTGTCACGGGTGCTGAACCAGCCCCAGAGCCTCTTAGTGGAGACA
  GTGGTGGTGGCCCGGGCCCTGAGGGGCCGTGGCTTTGGCCGCCGCCTCATGGAGGGCCTGGAGGTCTTTG
  CTCGGGCCCGGGGCTTCCGCAAGCTGCATCTCACCACCCATGACCAGGTGCACTTCTATACCCACCTGGG
  CTACCAGCTGGGTGAGCCTGTGCAGGGCCTGGTCTTCACCAGCAGACGGCTGCCTGCCACCCTGCTTAAT
  GCCTTCCCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAAACCTGACTGCCCAAGCTGCCCCAA
  GGGGTCCCAAGGGACCTCCATTGCCACCACCCCCTCCCCTACCTGAGTGCCTGACCATCTCACCCCCAGT
  TCCATCAGGGCCCCCTTCAAAAAGCCTGCTGGAGACACAATATCAAAATGTGAGGGGGCGCCCCATATTC
  TGGATGGAAAAAGACATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001200018
• ORF Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001200018.1, NP_001186947.1
• RefSeq Size: 1218
• RefSeq ORF: 861
• Locus ID: 24142
• Protein Pathways: Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
• Gene Summary: This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein.