NPL (NM_001200056) Human Untagged Clone

CAT#: SC331405

NPL (untagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NPL
• Synonyms: C1orf13; C112; NAL; NPL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001200056, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTTCCCAAAGAAGAAACTTCAGGGTCTTGTGGCTGCAACCATCACGCCAATGACTGAGAATGGAG
  AAATCAACTTTTCAGTAATTGGTCAGTATGTGGATTATCTTGTGAAAGAACAGGGAGTGAAGAACATTTT
  TGTGAATGGCACAACAGGAGAAGGCCTGTCCCTGAGCGTCTCAGAGCGTCGCCAGGTTGCAGAGGAGTGG
  GTGACAAAAGGGAAGGACAAGCTGGATCAGGTGATAATTCACGTAGGAGCACTGAGCTTGAAGGAGTCAC
  AGGAACTGGCCCAACATGCAGCAGAAATAGGAGCTGATGGCATCGCTGTCATTGCACCGTTCTTCCTCAA
  GCCATGGACCAAAGATATCCTGATTAATTTCCTAAAGGAAGTGGCTGCTGCCGCCCCTGCCCTGCCATTT
  TATTACTATCACATTCCTGCCTTGACAGGGGTAAAGATTCGTGCTGAGGAGTTGTTGGATGGGATTCTGG
  ATAAGATCCCCACCTTCCAAGGGCTGAAATTCAGTGATACAGATCTCTTAGACTTCGGGCAATGTGTTGA
  TCAGAATCGCCAGCAACAGTTTGCTTTCCTTTTTGGGGTGGATGAGCAACTGTTGAGTGCTCTGGTGATG
  GGAGCAACTGGAGCAGTGGGCAGTACCTATAACTACCTGGGAAAAAAGACAAACCAGATGTTGGAGGCTT
  TTGAACAAAAGGACTTCTCTTTAGCCCTGAACTATCAGTTTTGTATCCAGAGATTTATCAACTTTGTTGT
  CAAACTAGAAAACTCAAAACTCAAAGTTTCAAAGAACCAAAGGACTCTTCCTCTGGGCACCACAAACTTC
  CCCTTCCTCCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001200056
• ORF Size: 855 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001200056.1, NP_001186985.1
• RefSeq Size: 1988
• RefSeq ORF: 855
• Locus ID: 80896
• Protein Pathways: Amino sugar and nucleotide sugar metabolism
• Gene Summary: This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.