TECK (CCL25) (NM_001201359) Human Untagged Clone
CAT#: SC331413
CCL25 (untagged) - Homo sapiens chemokine (C-C motif) ligand 25 (CCL25), transcript variant 2
"NM_001201359" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "CCL25"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCL25 |
Synonyms | Ckb15; SCYA25; TECK |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001201359, the custom clone sequence may differ by one or more nucleotides
ATGAACCTGTGGCTCCTGGCCTGCCTGGTGGCCGGCTTCCTGGGAGCCTGGGCCCCCGCTGTCCACACCC AAGGTGTCTTTGAGGACTGCTGCCTGGCCTACCACTACCCCATTGGGTGGGCTGTGCTCCGGCGCGCCTG GACTTACCGGATCCAGGAGGTGAGCGGGAGCTGCAATCTGCCTGCTGCGATATTCTACCTCCCCAAGAGA CACAGGAAGGTGTGTGGGAACCCCAAAAGCAGGGAGGTGCAGAGAGCCATGAAGCTCCTGGATGCTCGAA ATAAGGTTTTTGCAAAGCTCCACCACAACACGCAGACCTTCCAAGGCCCTCATGCTGTAAAGAAGTTGAG TTCTGGAAACTCCAAGTTATCATCGTCCAAGTTTAGCAATCCCATCAGCAGCAGTAAGAGGAATGTCTCC CTCCTGATATCAGCTAATTCAGGACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201359 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001201359.1, NP_001188288.1 |
RefSeq Size | 999 bp |
RefSeq ORF | 450 bp |
Locus ID | 6370 |
Cytogenetics | 19p13.2 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Gene Summary | 'This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]' Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (2) is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.