MCK10 (DDR1) (NM_001202521) Human Untagged Clone

CAT#: SC331465

DDR1 (untagged) - Homo sapiens discoidin domain receptor tyrosine kinase 1 (DDR1), transcript variant 4


  "NM_001202521" in other vectors (2)

Reconstitution Protocol

USD 520.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "DDR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DDR1
Synonyms CAK; CD167; DDR; EDDR1; HGK2; MCK10; NEP; NTRK4; PTK3; PTK3A; RTK6; TRKE
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001202521, the custom clone sequence may differ by one or more nucleotides


ATGGGACCAGAGGCCCTGTCATCTTTACTGCTGCTGCTCTTGGTGGCAAGTGGAGATGCTGACATGAAGG
GACATTTTGATCCTGCCAAGTGCCGCTATGCCCTGGGCATGCAGGACCGGACCATCCCAGACAGTGACAT
CTCTGCTTCCAGCTCCTGGTCAGATTCCACTGCCGCCCGCCACAGCAGGTTGGAGAGCAGTGACGGGGAT
GGGGCCTGGTGCCCCGCAGGGTCGGTGTTTCCCAAGGAGGAGGAGTACTTGCAGGTGGATCTACAACGAC
TGCACCTGGTGGCTCTGGTGGGCACCCAGGGACGGCATGCCGGGGGCCTGGGCAAGGAGTTCTCCCGGAG
CTACCGGCTGCGTTACTCCCGGGATGGTCGCCGCTGGATGGGCTGGAAGGACCGCTGGGGTCAGGAGGTG
ATCTCAGGCAATGAGGACCCTGAGGGAGTGGTGCTGAAGGACCTTGGGCCCCCCATGGTTGCCCGACTGG
TTCGCTTCTACCCCCGGGCTGACCGGGTCATGAGCGTCTGTCTGCGGGTAGAGCTCTATGGCTGCCTCTG
GAGGGATGGACTCCTGTCTTACACCGCCCCTGTGGGGCAGACAATGTATTTATCTGAGGCCGTGTACCTC
AACGACTCCACCTATGACGGACATACCGTGGGCGGACTGCAGTATGGGGGTCTGGGCCAGCTGGCAGATG
GTGTGGTGGGGCTGGATGACTTTAGGAAGAGTCAGGAGCTGCGGGTCTGGCCAGGCTATGACTATGTGGG
ATGGAGCAACCACAGCTTCTCCAGTGGCTATGTGGAGATGGAGTTTGAGTTTGACCGGCTGAGGGCCTTC
CAGGCTATGCAGGTCCACTGTAACAACATGCACACGCTGGGAGCCCGTCTGCCTGGCGGGGTGGAATGTC
GCTTCCGGCGTGGCCCTGCCATGGCCTGGGAGGGGGAGCCCATGCGCCACAACCTAGGGGGCAACCTGGG
GGACCCCAGAGCCCGGGCTGTCTCAGTGCCCCTTGGCGGCCGTGTGGCTCGCTTTCTGCAGTGCCGCTTC
CTCTTTGCGGGGCCCTGGTTACTCTTCAGCGAAATCTCCTTCATCTCTGATGTGGTGAACAATTCCTCTC
CGGCACTGGGAGGCACCTTCCCGCCAGCCCCCTGGTGGCCGCCTGGCCCACCTCCCACCAACTTCAGCAG
CTTGGAGCTGGAGCCCAGAGGCCAGCAGCCCGTGGCCAAGGCCGAGGGGAGCCCGACCGCCATCCTCATC
GGCTGCCTGGTGGCCATCATCCTGCTCCTGCTGCTCATCATTGCCCTCATGCTCTGGCGGCTGCACTGGC
GCAGGCTCCTCAGCAAGGCTGAACGGAGGGTGTTGGAAGAGGAGCTGACGGTTCACCTCTCTGTCCCTGG
GGACACTATCCTCATCAACAACCGCCCAGGTCCTAGAGAGCCACCCCCGTACCAGGAGCCCCGGCCTCGT
GGGAATCCGCCCCACTCCGCTCCCTGTGTCCCCAATGGCTCTGGTGCACCTGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001202521
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202521.1, NP_001189450.1
RefSeq Size 3304 bp
RefSeq ORF 1527 bp
Locus ID 780
Cytogenetics 6p21.33
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Gene Summary 'Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (4) is missing an internal coding exon compared to variant 1. This results in a frame-shift, and early translation termination, rendering this transcript a candidate for nonsense-mediated mRNA decay (NMD). However, the encoded isoform (4, also known as DDR1d) is represented as it has been detected in vivo in several colon carcinoma cell lines (PMID:11344127). This isoform is truncated and lacks the catalytic tyrosine kinase domain, therefore, most likely lacks intrinsic tyrosine kinase activity. It may function in some other regulatory capacity.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.