MCK10 (DDR1) (NM_001202521) Human Untagged Clone
CAT#: SC331465
DDR1 (untagged) - Homo sapiens discoidin domain receptor tyrosine kinase 1 (DDR1), transcript variant 4
"NM_001202521" in other vectors (2)
Product Images
Other products for "DDR1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DDR1 |
Synonyms | CAK; CD167; DDR; EDDR1; HGK2; MCK10; NEP; NTRK4; PTK3; PTK3A; RTK6; TRKE |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001202521, the custom clone sequence may differ by one or more nucleotides
ATGGGACCAGAGGCCCTGTCATCTTTACTGCTGCTGCTCTTGGTGGCAAGTGGAGATGCTGACATGAAGG GACATTTTGATCCTGCCAAGTGCCGCTATGCCCTGGGCATGCAGGACCGGACCATCCCAGACAGTGACAT CTCTGCTTCCAGCTCCTGGTCAGATTCCACTGCCGCCCGCCACAGCAGGTTGGAGAGCAGTGACGGGGAT GGGGCCTGGTGCCCCGCAGGGTCGGTGTTTCCCAAGGAGGAGGAGTACTTGCAGGTGGATCTACAACGAC TGCACCTGGTGGCTCTGGTGGGCACCCAGGGACGGCATGCCGGGGGCCTGGGCAAGGAGTTCTCCCGGAG CTACCGGCTGCGTTACTCCCGGGATGGTCGCCGCTGGATGGGCTGGAAGGACCGCTGGGGTCAGGAGGTG ATCTCAGGCAATGAGGACCCTGAGGGAGTGGTGCTGAAGGACCTTGGGCCCCCCATGGTTGCCCGACTGG TTCGCTTCTACCCCCGGGCTGACCGGGTCATGAGCGTCTGTCTGCGGGTAGAGCTCTATGGCTGCCTCTG GAGGGATGGACTCCTGTCTTACACCGCCCCTGTGGGGCAGACAATGTATTTATCTGAGGCCGTGTACCTC AACGACTCCACCTATGACGGACATACCGTGGGCGGACTGCAGTATGGGGGTCTGGGCCAGCTGGCAGATG GTGTGGTGGGGCTGGATGACTTTAGGAAGAGTCAGGAGCTGCGGGTCTGGCCAGGCTATGACTATGTGGG ATGGAGCAACCACAGCTTCTCCAGTGGCTATGTGGAGATGGAGTTTGAGTTTGACCGGCTGAGGGCCTTC CAGGCTATGCAGGTCCACTGTAACAACATGCACACGCTGGGAGCCCGTCTGCCTGGCGGGGTGGAATGTC GCTTCCGGCGTGGCCCTGCCATGGCCTGGGAGGGGGAGCCCATGCGCCACAACCTAGGGGGCAACCTGGG GGACCCCAGAGCCCGGGCTGTCTCAGTGCCCCTTGGCGGCCGTGTGGCTCGCTTTCTGCAGTGCCGCTTC CTCTTTGCGGGGCCCTGGTTACTCTTCAGCGAAATCTCCTTCATCTCTGATGTGGTGAACAATTCCTCTC CGGCACTGGGAGGCACCTTCCCGCCAGCCCCCTGGTGGCCGCCTGGCCCACCTCCCACCAACTTCAGCAG CTTGGAGCTGGAGCCCAGAGGCCAGCAGCCCGTGGCCAAGGCCGAGGGGAGCCCGACCGCCATCCTCATC GGCTGCCTGGTGGCCATCATCCTGCTCCTGCTGCTCATCATTGCCCTCATGCTCTGGCGGCTGCACTGGC GCAGGCTCCTCAGCAAGGCTGAACGGAGGGTGTTGGAAGAGGAGCTGACGGTTCACCTCTCTGTCCCTGG GGACACTATCCTCATCAACAACCGCCCAGGTCCTAGAGAGCCACCCCCGTACCAGGAGCCCCGGCCTCGT GGGAATCCGCCCCACTCCGCTCCCTGTGTCCCCAATGGCTCTGGTGCACCTGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001202521 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001202521.1, NP_001189450.1 |
RefSeq Size | 3304 bp |
RefSeq ORF | 1527 bp |
Locus ID | 780 |
Cytogenetics | 6p21.33 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Gene Summary | 'Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]' Transcript Variant: This variant (4) is missing an internal coding exon compared to variant 1. This results in a frame-shift, and early translation termination, rendering this transcript a candidate for nonsense-mediated mRNA decay (NMD). However, the encoded isoform (4, also known as DDR1d) is represented as it has been detected in vivo in several colon carcinoma cell lines (PMID:11344127). This isoform is truncated and lacks the catalytic tyrosine kinase domain, therefore, most likely lacks intrinsic tyrosine kinase activity. It may function in some other regulatory capacity. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.