SPOCK3 (NM_001204353) Human Untagged Clone

CAT#: SC331564

SPOCK3 (untagged) - Homo sapiens sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 (SPOCK3), transcript variant 4


  "NM_001204353" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPOCK3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPOCK3
Synonyms HSAJ1454; TES-3; TICN3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001204353, the custom clone sequence may differ by one or more nucleotides


ATGAAAGAAGCAGGAGTAGACCATAGGCAGTGGAGGGGTCCCATATTATCCACCTGCAAGCAGTGCCCAG
TGGTCTATCCCAGCCCTGTTTGTGGTTCAGATGGTCATACCTACTCTTTTCAGTGCAAACTAGAATATCA
GGCATGTGTCTTAGGAAAACAGATCTCAGTCAAATGTGAAGGACATTGCCCATGTCCTTCAGATAAGCCC
ACCAGTACAAGCAGAAATGTTAAGAGAGCATGCAGTGACCTGGAGTTCAGGGAAGTGGCAAACAGATTGC
GGGACTGGTTCAAGGCCCTTCATGAAAGTGGAAGTCAAAACAAGAAGACAAAAACATTGCTGAGGCCTGA
GAGAAGCAGATTCGATACCAGCATCTTGCCAATTTGCAAGGACTCACTTGGCTGGATGTTTAACAGACTT
GATACAAACTATGACCTGCTATTGGACCAGTCAGAGCTCAGAAGCATTTACCTTGATAAGAATGAACAGT
GTACCAAGGCATTCTTCAATTCTTGTGACACATACAAGGACAGTTTAATATCTAATAATGAGTGGTGCTA
CTGCTTCCAGAGACAGCAAGACCCACCTTGCCAGACTGAGCTCAGCAATATTCAGAAGCGGCAAGGGGTA
AAGAAGCTCCTAGGACAGTATATCCCCCTGTGTGATGAAGATGGTTACTACAAGCCAACACAATGTCATG
GCAGTGTTGGACAGTGCTGGTGTGTTGACAGATATGGAAATGAAGTCATGGGATCCAGAATAAATGGTGT
TGCAGATTGTGCTATAGATTTTGAGATCTCCGGAGATTTTGCTAGTGGCGATTTTCATGAATGGACTGAT
GATGAGGATGATGAAGACGATATTATGAATGATGAAGATGAAATTGAAGATGATGATGAAGATGAAGGGG
ATGATGATGATGGTGGTGATGACCATGATGTATACATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001204353
ORF Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001204353.1, NP_001191282.1
RefSeq Size 2797
RefSeq ORF 951
Locus ID 50859
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks two exons and uses a downstream, in-frame start codon, compared to variant 2. The encoded isoform (4) has a shorter N-terminus, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.