Syntaxin 16 (STX16) (NM_001204868) Human Untagged Clone

CAT#: SC331621

STX16 (untagged) - Homo sapiens syntaxin 16 (STX16), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STX16
• Synonyms: SYN16
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204868, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCACTGGTGTCAGGCATCAGCTTAGATCCAGAAGCAGCGATTGGTGTGACAAAACGGCCACCTCCTA
  AGTGGGTGGATGGAGTGGATGAAATTCAGTATGATGTTGGCCGGATTAAGCAGAAGATGAAAGAATTGGC
  CAGCCTTCATGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGCGAAGAGGAACATGCCATTGAG
  ATAACTACCCAAGAGATCACTCAGCTCTTCCACAGGTGCCAGCGTGCCGTGCAGGCCCTGCCGAGCCGGG
  CCCGGGCCTGCTCCGAGCAGGAGGGGCGGCTGCTTGGGAACGTGGTGGCCTCGCTGGCGCAGGCCCTGCA
  GGAACTCTCCACCAGCTTCCGGCACGCACAGTCAGGCTACCTCAAACGCATGAAGAATCGAGAGGAAAGA
  TCCCAGCATTTTTTCGACACATCAGTACCACTAATGGATGATGGAGACGATAACACTCTTTACCATCGGG
  GTTTTACAGAGGACCAGTTAGTTCTGGTGGAGCAGAACACACTGATGGTGGAAGAGCGGGAACGAGAGAT
  TCGCCAGATTGTACAGTCCATTTCTGACCTGAATGAAATATTCAGGGACTTAGGGGCGATGATTGTAGAA
  CAGGGTACAGTCCTTGACAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGTTTGA
  AACAGCTTCACAAGGCAGAACAGTATCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATATTATTTGT
  CATCATCATTGTGCTCATTGTTGTCCTCGTTGGCGTGAAGTCTCGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204868
• ORF Size: 819 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204868.1, NP_001191797.1
• RefSeq Size: 4340
• RefSeq ORF: 819
• Locus ID: 8675
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (e) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.