Junctional Adhesion Molecule C (JAM3) (NM_001205329) Human Untagged Clone

CAT#: SC331652

JAM3 (untagged) - Homo sapiens junctional adhesion molecule 3 (JAM3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: JAM3
• Synonyms: JAM-2; JAM-3; JAM-C; JAMC
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001205329, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCTGAGGCGGCCACCGCGACTCCGGCTCTGCGCTCGGCTGCCTGACTTCTTCCTGCTGCTGCTTT
  TCAGGGGCTGCCTGATAGGGGCTGTAAATCTCAAATCCAGCAATCGAACCCCAGTGGTACAGGAATTTGA
  AAGTGTGGAACTGTCTTGCATCATTACGGATTCGCAGACAAGTGACCCCAGGATCGAGTGGAAGAAAATT
  CAAGATGAACAAACCACATATGTGTTTTTTGACAACAAAATTCAGGTGAAGCCAGTGACCCCTGTCTGTA
  GAGTGCCGAAGGCTGTACCAGTAGGCAAGATGGCAACACTGCACTGCCAGGAGAGTGAGGGCCACCCCCG
  GCCTCACTACAGCTGGTATCGCAATGATGTACCACTGCCCACGGATTCCAGAGCCAATCCCAGATTTCGC
  AATTCTTCTTTCCACTTAAACTCTGAAACAGGCACTTTGGTGTTCACTGCTGTTCACAAGGACGACTCTG
  GGCAGTACTACTGCATTGCTTCCAATGACGCAGGCTCAGCCAGGTGTGAGGAGCAGGAGATGGAAGTCTA
  TGACCTGAACATTGGCGGAATTATTGGGGGGGTTCTGGTTGTCCTTGCTGTACTGGCCCTGATCACGTTG
  GGCATCTGCTGTGCATACAGACGTGGCTACTTCATCAACAATAAACAGGATGGAGAAAGTTACAAGAACC
  CAGGGAAACCAGATGGAGTTAACTACATCCGCACTGACGAGGAGGGCGACTTCAGACACAAGTCATCGTT
  TGTGATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205329
• ORF Size: 780 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001205329.1, NP_001192258.1
• RefSeq Size: 3515
• RefSeq ORF: 780
• Locus ID: 83700
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Epithelial cell signaling in Helicobacter pylori infection, Leukocyte transendothelial migration, Tight junction
• Gene Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.