CEACAM1 (NM_001205344) Human Untagged Clone

CAT#: SC331653

CEACAM1 (untagged) - Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CEACAM1
• Synonyms: BGP; BGP1; BGPI
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001205344, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCACCTCTCAGCCCCACTTCACAGAGTGCGTGTACCCTGGCAGGGGCTTCTGCTCACAGCCTCAC
  TTCTAACCTTCTGGAACCCGCCCACCACTGCCCAGCTCACTACTGAATCCATGCCATTCAATGTTGCAGA
  GGGGAAGGAGGTTCTTCTCCTTGTCCACAATCTGCCCCAGCAACTTTTTGGCTACAGCTGGTACAAAGGG
  GAAAGAGTGGATGGCAACCGTCAAATTGTAGGATATGCAATAGGAACTCAACAAGCTACCCCAGGGCCCG
  CAAACAGCGGTCGAGAGACAATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAATGACAC
  AGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTA
  TACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCTGTGGAGGACAAGGATGCTGTGG
  CCTTCACCTGTGAACCTGAGACTCAGGACACAACCTACCTGTGGTGGATAAACAATCAGAGCCTCCCGGT
  CAGTCCCAGGCTGCAGCTGTCCAATGGCAACAGGACCCTCACTCTACTCAGTGTCACAAGGAATGACACA
  GGACCCTATGAGTGTGAAATACAGAACCCAGTGAGTGCGAACCGCAGTGACCCAGTCACCTTGAATGTCA
  CCTATGGCCCGGACACCCCCACCATTTCCCCTTCAGACACCTATTACCGTCCAGGGGCAAACCTCAGCCT
  CTCCTGCTATGCAGCCTCTAACCCACCTGCACAGTACTCCTGGCTTATCAATGGAACATTCCAGCAAAGC
  ACACAAGAGCTCTTTATCCCTAACATCACTGTGAATAATAGTGGATCCTATACCTGCCACGCCAATAACT
  CAGTCACTGGCTGCAACAGGACCACAGTCAAGACGATCATAGTCACTGAGCTAAGTCCAGTAGTAGCAAA
  GCCCCAAATCAAAGCCAGCAAGACCACAGTCACAGGAGATAAGGACTCTGTGAACCTGACCTGCTCCACA
  AATGACACTGGAATCTCCATCCGTTGGTTCTTCAAAAACCAGAGTCTCCCGTCCTCGGAGAGGATGAAGC
  TGTCCCAGGGCAACACCACCCTCAGCATAAACCCTGTCAAGAGGGAGGATGCTGGGACGTATTGGTGTGA
  GGTCTTCAACCCAATCAGTAAGAACCAAAGCGACCCCATCATGCTGAACGTAAACTATAATGCTCTACCA
  CAAGAAAATGGCCTCTCACCTGGGGCCATTGCTGGCATTGTGATTGGAGTAGTGGCCCTGGTTGCTCTGA
  TAGCAGTAGCCCTGGCATGTTTTCTGCATTTCGGGAAGACCGGCAGGACCACTCCAATGACCCACCTAAC
  AAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205344
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001205344.1, NP_001192273.1
• RefSeq Size: 3470 bp
• RefSeq ORF: 1407 bp
• Locus ID: 634
• Cytogenetics: 19q13.2
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'This gene encodes a member of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily. Two subgroups of the CEA family, the CEA cell adhesion molecules and the pregnancy-specific glycoproteins, are located within a 1.2 Mb cluster on the long arm of chromosome 19. Eleven pseudogenes of the CEA cell adhesion molecule subgroup are also found in the cluster. The encoded protein was originally described in bile ducts of liver as biliary glycoprotein. Subsequently, it was found to be a cell-cell adhesion molecule detected on leukocytes, epithelia, and endothelia. The encoded protein mediates cell adhesion via homophilic as well as heterophilic binding to other proteins of the subgroup. Multiple cellular activities have been attributed to the encoded protein, including roles in the differentiation and arrangement of tissue three-dimensional structure, angiogenesis, apoptosis, tumor suppression, metastasis, and the modulation of innate and adaptive immune responses. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature of all variants has not been defined. [provided by RefSeq, May 2010]'
  Transcript Variant: This variant (6) lacks a segment, which results in a frameshift, compared to variant 1. The resulting protein (isoform 6) has a distinct C-terminus, compared to isoform 1.