CHN 1 (CHN1) (NM_001206602) Human Untagged Clone

CAT#: SC331662

CHN1 (untagged) - Homo sapiens chimerin 1 (CHN1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHN1
• Synonyms: ARHGAP2; CHN; DURS2; NC; RHOGAP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206602, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCATCCAAAGAGTCTTGGTCAGGGAGGAAAACTAATAGGGCTGCAGTTCACAAATCAAAACAAGAGG
  GCCGTCAGCAAGATTTATTGATAGCAGCCTTGGGAATGAAACTGGGTTCTCCAAAGTCGTCTGTGACAAT
  CTGGCAACCTCTGAAACTCTTTGCTTATTCGCAGTTGACATCACTTGTTAGAAGAGCAACTCTGAAAGAA
  AACGAGCAAATTCCAAAATATGAAAAGATTCACAATTTCAAGGTGCATACATTCAGAGGGCCACACTGGT
  GTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGATTGTGGTTTGAA
  TGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAGCCAGACTTGAAGCATGTCAAAAAGGTG
  TACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCA
  TCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAAT
  TGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGAT
  ATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATG
  CCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGC
  ACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGAGTGACC
  CTCCACGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTTGGACCCACCCTTATGAGAT
  CTCCAGAACTAGACGCCATGGCTGCATTGAATGATATACGGTATCAGAGACTGGTGGTGGAGCTGCTTAT
  CAAAAACGAAGACATTTTATTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206602
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206602.1, NP_001193531.1
• RefSeq Size: 2294 bp
• RefSeq ORF: 1005 bp
• Locus ID: 1123
• Cytogenetics: 2q31.1
• Gene Summary: 'This gene encodes GTPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. Mutations in this gene are associated with Duane's retraction syndrome 2 (DURS2). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]'
  Transcript Variant: This variant (3) uses an alternate promoter, and is missing several exons from the 5' end compared to variant 1. This results in a shorter isoform (3, also known as alpha 1-chimerin) with a distinct N-terminus compared to isoform 1.