CD162 (SELPLG) (NM_001206609) Human Untagged Clone

CAT#: SC331663

SELPLG (untagged) - Homo sapiens selectin P ligand (SELPLG), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SELPLG
• Synonyms: CD162; CLA; PSGL-1; PSGL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206609, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGTGGGGGCCAGTGGTCTAGAAGGAGATAAGATGGCTGGTGCCATGCCTCTGCAACTCCTCCTGT
  TGCTGATCCTACTGGGCCCTGGCAACAGCTTGCAGCTGTGGGACACCTGGGCAGATGAAGCCGAGAAAGC
  CTTGGGTCCCCTGCTTGCCCGGGACCGGAGACAGGCCACCGAATATGAGTACCTAGATTATGATTTCCTG
  CCAGAAACGGAGCCTCCAGAAATGCTGAGGAACAGCACTGACACCACTCCTCTGACTGGGCCTGGAACCC
  CTGAGTCTACCACTGTGGAGCCTGCTGCAAGGCGTTCTACTGGCCTGGATGCAGGAGGGGCAGTCACAGA
  GCTGACCACGGAGCTGGCCAACATGGGGAACCTGTCCACGGATTCAGCAGCTATGGAGATACAGACCACT
  CAACCAGCAGCCACGGAGGCACAGACCACTCAACCAGTGCCCACGGAGGCACAGACCACTCCACTGGCAG
  CCACAGAGGCACAGACAACTCGACTGACGGCCACGGAGGCACAGACCACTCCACTGGCAGCCACAGAGGC
  ACAGACCACTCCACCAGCAGCCACGGAAGCACAGACCACTCAACCCACAGGCCTGGAGGCACAGACCACT
  GCACCAGCAGCCATGGAGGCACAGACCACTGCACCAGCAGCCATGGAAGCACAGACCACTCCACCAGCAG
  CCATGGAGGCACAGACCACTCAAACCACAGCCATGGAGGCACAGACCACTGCACCAGAAGCCACGGAGGC
  ACAGACCACTCAACCCACAGCCACGGAGGCACAGACCACTCCACTGGCAGCCATGGAGGCCCTGTCCACA
  GAACCCAGTGCCACAGAGGCCCTGTCCATGGAACCTACTACCAAAAGAGGTCTGTTCATACCCTTTTCTG
  TGTCCTCTGTTACTCACAAGGGCATTCCCATGGCAGCCAGCAATTTGTCCGTCAACTACCCAGTGGGGGC
  CCCAGACCACATCTCTGTGAAGCAGTGCCTGCTGGCCATCCTAATCTTGGCGCTGGTGGCCACTATCTTC
  TTCGTGTGCACTGTGGTGCTGGCGGTCCGCCTCTCCCGCAAGGGCCACATGTACCCCGTGCGTAATTACT
  CCCCCACCGAGATGGTCTGCATCTCATCCCTGTTGCCTGATGGGGGTGAGGGGCCCTCTGCCACAGCCAA
  TGGGGGCCTGTCCAAGGCCAAGAGCCCGGGCCTGACGCCAGAGCCCAGGGAGGACCGTGAGGGGGATGAC
  CTCACCCTGCACAGCTTCCTCCCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206609
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206609.1, NP_001193538.1
• RefSeq Size: 2638 bp
• RefSeq ORF: 1287 bp
• Locus ID: 6404
• Cytogenetics: 12q24.11
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs)
• Gene Summary: 'This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.