MEK5 (MAP2K5) (NM_001206804) Human Untagged Clone

CAT#: SC331687

MAP2K5 (untagged) - Homo sapiens mitogen-activated protein kinase kinase 5 (MAP2K5), transcript variant 3


  "NM_001206804" in other vectors (2)

Reconstitution Protocol

USD 410.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP2K5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP2K5
Synonyms HsT17454; MAPKK5; MEK5; PRKMK5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206804, the custom clone sequence may differ by one or more nucleotides


ATGATGGAGGGTCACTTTCCCCAGAGCGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCAT
TTGAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCAATGCTGTC
ATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAGCCTCTGCAGATATTTCCA
AGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTGAAGGTGAATACTCGGGCCGGACCCTCTC
AACACAGCAGCCCAGCAGTCTCAGATTCACTTCCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAA
AAAAATACTAGCCAATGGCCAGATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAAC
GGAGGCACAGTCTACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAG
ATATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGATTCATCATA
TATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGTACAGAATTCATGGATGGG
GGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTTGGAAGAATTGCAGTAGCAGTTGTTAAAG
GCCTTACTTATTTGTGGAGTTTAAAGATTTTACATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACAC
AAGAGGACAGGTTAAGCTGTGTGATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTAT
GTTGGAACAAATGCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCT
GGAGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAGATTCAGAAAAACCA
GGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCGCCCGTCCTTCCAGTTGGA
GAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATGCGAAAACAGCCAAAAGAAAGGCCAGCAC
CTGAAGAATTGATGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTG
GGTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001206804
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206804.1, NP_001193733.1
RefSeq Size 1801 bp
RefSeq ORF 1239 bp
Locus ID 5607
Cytogenetics 15q23
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Gap junction, MAPK signaling pathway, Neurotrophin signaling pathway
Gene Summary 'The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]'
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (C) has a shorter and distinct N-terminus compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.