MEK5 (MAP2K5) (NM_001206804) Human Untagged Clone
CAT#: SC331687
MAP2K5 (untagged) - Homo sapiens mitogen-activated protein kinase kinase 5 (MAP2K5), transcript variant 3
"NM_001206804" in other vectors (2)
Product Images
Other products for "MAP2K5"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAP2K5 |
Synonyms | HsT17454; MAPKK5; MEK5; PRKMK5 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206804, the custom clone sequence may differ by one or more nucleotides
ATGATGGAGGGTCACTTTCCCCAGAGCGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCAT TTGAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCAATGCTGTC ATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAGCCTCTGCAGATATTTCCA AGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTGAAGGTGAATACTCGGGCCGGACCCTCTC AACACAGCAGCCCAGCAGTCTCAGATTCACTTCCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAA AAAAATACTAGCCAATGGCCAGATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAAC GGAGGCACAGTCTACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAG ATATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGATTCATCATA TATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGTACAGAATTCATGGATGGG GGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTTGGAAGAATTGCAGTAGCAGTTGTTAAAG GCCTTACTTATTTGTGGAGTTTAAAGATTTTACATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACAC AAGAGGACAGGTTAAGCTGTGTGATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTAT GTTGGAACAAATGCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCT GGAGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAGATTCAGAAAAACCA GGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCGCCCGTCCTTCCAGTTGGA GAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATGCGAAAACAGCCAAAAGAAAGGCCAGCAC CTGAAGAATTGATGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTG GGTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206804 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001206804.1, NP_001193733.1 |
RefSeq Size | 1801 bp |
RefSeq ORF | 1239 bp |
Locus ID | 5607 |
Cytogenetics | 15q23 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Gap junction, MAPK signaling pathway, Neurotrophin signaling pathway |
Gene Summary | 'The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]' Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (C) has a shorter and distinct N-terminus compared to isoform A. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.