Ikaros (IKZF1) (NM_001220772) Human Untagged Clone
CAT#: SC331777
IKZF1 (untagged) - Homo sapiens IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant 9
"NM_001220772" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "IKZF1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IKZF1 |
Synonyms | hIk-1; Hs.54452; IK1; IKAROS; LYF1; PRO0758; ZNFN1A1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001220772, the custom clone sequence may differ by one or more nucleotides
ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGGGACAAGGGCCTGTCCGACACGCCCTACG ACAGCAGCGCCAGCTACGAGAAGGAGAACGAAATGATGAAGTCCCACGTGATGGACCAAGCCATCAACAA CGCCATCAACTACCTGGGGGCCGAGTCCCTGCGCCCGCTGGTGCAGACGCCCCCGGGCGGTTCCGAGGTG GTCCCGGTCATCAGCCCGATGTACCAGCTGCACAAGCCGCTCGCGGAGGGCACCCCGCGCTCCAACCACT CGGCCCAGGACAGCGCCGTGGAGAACCTGCTGCTGCTCTCCAAGGCCAAGTTGGTGCCCTCGGAGCGCGA GGCGTCCCCGAGCAACAGCTGCCAAGACTCCACGGACACCGAGAGCAACAACGAGGAGCAGCGCAGCGGT CTCATCTACCTGACCAACCACATCGCCCCGCACGCGCGCAACGGGCTGTCGCTCAAGGAGGAGCACCGCG CCTACGACCTGCTGCGCGCCGCCTCCGAGAACTCGCAGGACGCGCTCCGCGTGGTCAGCACCAGCGGGGA GCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCAC ATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACG AGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCCACATGAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001220772 |
ORF Size | 750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001220772.1, NP_001207701.1 |
RefSeq Size | 5407 |
RefSeq ORF | 750 |
Locus ID | 10320 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014] Transcript Variant: This variant (9) lacks four consecutive in-frame coding exons compared to variant 1. This results in a shorter isoform (9, also known as Ik-6 as described by Ezzat et al. in PMID:12937159) missing an internal protein segment compared to isoform 1. This isoform contains no N-terminal zinc finger motif, is localized in the cytoplasm, and functions as a non-DNA-binding, dominant negative isoform (PMIDs:12937159, 10463586). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.