WDR20 (NM_001242415) Human Untagged Clone

CAT#: SC331798

WDR20 (untagged) - Homo sapiens WD repeat domain 20 (WDR20), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WDR20
• Synonyms: DMR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242415, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGACGGAGGGAGGAGGGAAGGAGATGAACGAGATTAAGACCCAATTCACCACCCGGGAAGGTCTGT
  ACAAGCTGCTGCCGCACTCGGAGTACAGCCGGCCCAACCGGGTGCCCTTCAACTCGCAGGGATCCAACCC
  TGTCCGCGTCTCCTTCGTAAACCTCAACGACCAGTCTGGCAACGGCGACCGCCTCTGCTTCAATGTGGGC
  CGGGAGCTGTACTTCTATATCTACAAGGGGGTCCGCAAGGCTGCTGACTTGAGTAAACCAATAGATAAAA
  GGATATACAAAGGAACACAGCCTACTTGTCATGACTTCAACCACCTAACAGCCACAGCAGAAAGTGTCTC
  TCTCCTAGTGGGCTTTTCCGCAGGCCAAGTCCAGCTTATAGACCCAATCAAAAAAGAAACTAGCAAACTT
  TTTAATGAGGAAAACTCTTGTCAGCACTTGTGGAAGGTGGATTGGAATGAAGAAAGACAGAATGAAGGTA
  GCAAGACCAGTGAGGAGGCTCTAGTAACTGTCCAGCCGGCAGAGCACTTCTGCAGGCAGGAGGACAGGAT
  GCAAGGTGTTCTCCAAGACCAGAACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242415
• ORF Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242415.1, NP_001229344.1
• RefSeq Size: 3102
• RefSeq ORF: 588
• Locus ID: 91833
• Gene Summary: This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (5) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (5) has a distinct and significantly shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.