PI 3 Kinase p85 alpha (PIK3R1) (NM_001242466) Human Untagged Clone
CAT#: SC331807
PIK3R1 (untagged) - Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), transcript variant 4
"NM_001242466" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PIK3R1 |
Synonyms | AGM7; GRB1; IMD36; p85; p85-ALPHA |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242466, the custom clone sequence may differ by one or more nucleotides
ATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTAATCAAAATATTTCATCGAG ATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCTGTGGTTGAATTAATAAACCACTACCGGAA TGAATCTCTAGCTCAGTATAATCCCAAATTGGATGTGAAATTACTTTATCCAGTATCCAAATACCAACAG GATCAAGTTGTCAAAGAAGATAATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTC AAGAAAAAAGTCGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAA AAGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACCCAAGAGCGG TACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAAATACAAAGGATTATGCATA ATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGACAGTAGAAGAAGATTGGAAGAAGACTTGAA GAAGCAGGCAGCTGAGTATCGAGAAATTGACAAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTG AGAAAGACGAGAGACCAATACTTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGT GGTTGGGCAATGAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGA TGAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGGAAGCGAGAT GGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCTGTAGTGGTGGACGGCGAAG TAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGCTTTGCCGAGCCCTATAACTTGTACAGCTC TCTGAAAGAACTGGTGCTACATTACCAACACACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACA CTAGCCTACCCAGTATATGCACAGCAGAGGCGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242466 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242466.1, NP_001229395.1 |
RefSeq Size | 5554 bp |
RefSeq ORF | 1086 bp |
Locus ID | 5295 |
Cytogenetics | 5q13.1 |
Protein Families | Druggable Genome |
Protein Pathways | Acute myeloid leukemia, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, Leukocyte transendothelial migration, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Phosphatidylinositol signaling system, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, VEGF signaling pathway |
Gene Summary | 'Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]' Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233876 | PIK3R1 (Myc-DDK tagged) - Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), transcript variant 4 |
USD 420.00 |
|
RG233876 | PIK3R1 (GFP-tagged) - Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review