PI 3 Kinase p85 alpha (PIK3R1) (NM_001242466) Human Untagged Clone

CAT#: SC331807

PIK3R1 (untagged) - Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), transcript variant 4


  "NM_001242466" in other vectors (2)

Reconstitution Protocol

USD 370.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "PIK3R1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PIK3R1
Synonyms AGM7; GRB1; IMD36; p85; p85-ALPHA
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242466, the custom clone sequence may differ by one or more nucleotides


ATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTAATCAAAATATTTCATCGAG
ATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCTGTGGTTGAATTAATAAACCACTACCGGAA
TGAATCTCTAGCTCAGTATAATCCCAAATTGGATGTGAAATTACTTTATCCAGTATCCAAATACCAACAG
GATCAAGTTGTCAAAGAAGATAATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTC
AAGAAAAAAGTCGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAA
AAGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACCCAAGAGCGG
TACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAAATACAAAGGATTATGCATA
ATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGACAGTAGAAGAAGATTGGAAGAAGACTTGAA
GAAGCAGGCAGCTGAGTATCGAGAAATTGACAAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTG
AGAAAGACGAGAGACCAATACTTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGT
GGTTGGGCAATGAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGA
TGAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGGAAGCGAGAT
GGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCTGTAGTGGTGGACGGCGAAG
TAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGCTTTGCCGAGCCCTATAACTTGTACAGCTC
TCTGAAAGAACTGGTGCTACATTACCAACACACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACA
CTAGCCTACCCAGTATATGCACAGCAGAGGCGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001242466
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242466.1, NP_001229395.1
RefSeq Size 5554 bp
RefSeq ORF 1086 bp
Locus ID 5295
Cytogenetics 5q13.1
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, Leukocyte transendothelial migration, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Phosphatidylinositol signaling system, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, VEGF signaling pathway
Gene Summary 'Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]'
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.