BRF1 (NM_001242790) Human Untagged Clone

CAT#: SC331860

BRF1 (untagged) - Homo sapiens BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit (BRF1), transcript variant 8


  "NM_001242790" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BRF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BRF1
Synonyms BRF; BRF-1; CFDS; GTF3B; hBRF; HEL-S-76p; TAF3B2; TAF3C; TAFIII90; TF3B90; TFIIIB90
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242790, the custom clone sequence may differ by one or more nucleotides


ATGACGGGCCGCGTGTGCCGCGGTTGCGGCGGCACGGACATCGAGCTGGACGCGGCGCGCGGGGACGCGG
TGTGCACCGCCTGCGGCTCAGTGCTGGAGGACAACATCATCGTGTCCGAGGTGCAGTTCGTGGAGAGCAG
CGGCGGCGGCTCCTCGGCCGTGGGCCAGTTCGTGTCCCTGGACGGTGCTGGCAAAACCCCGACTCTGGGT
GGCGGCTTCCACGTGAATCTGGGGAAGGAGTCGAGAGCGCAGACCCTGCAGAATGGGAGGCGCCACATCC
ACCACCTGGGGAACCAGCTGCAGCTGAACCAGCACTGCCTGGACACCGCCTTCAACTTCTTCAAGATGGC
CGTGAGCAGGCACCTGACCCGCGGCCGGAAGATGGCCCACGTGATTGCTGCCTGCCTCTACCTGGTCTGC
CGTACGGAGGGCACGCCGCACATGCTCCTGGACCTCAGCGACCTGCTCCAGGTAGACAGCCTCCGTCCTG
CATCTTTCCCCACCTGGGGTTGTGACCTGGGGGTTGTGACCAGGGTTGTGACCGGGGTGTACCCCAGGTG
CCTCCACGCATCTCAGTGGCCGGTCTGTGCTGCCTGCCCAGTCAGGAAGTTTTGGTCTGTAGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001242790
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242790.1, NP_001229719.1
RefSeq Size 1170 bp
RefSeq ORF 627 bp
Locus ID 2972
Cytogenetics 14q32.33
Protein Families Transcription Factors
Gene Summary 'This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]'
Transcript Variant: This variant (8) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (8) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.