MS4A4A (NM_001243266) Human Untagged Clone
CAT#: SC331985
MS4A4A (untagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3
"NM_001243266" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MS4A4A |
Synonyms | 4SPAN1; CD20-L1; CD20L1; HDCME31P; MS4A4; MS4A7 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243266, the custom clone sequence may differ by one or more nucleotides
ATGCATCAGACCTACAGCAGACATTGCAGGCCTGAAGAAAGCACCTTTTCTGCTGCCATGACAACCATGC AAGGAATGGAACAGGCCATGCCAGGGGCTGGCCCTGGTGTGCCCCAGCTGGGAAACATGGCTGTCATACA TTCACATCTGTGGAAAGGATTGCAAGAGAAGTTCTTGAAGGGAGAACCCAAAGTCCTTGGGGTTGTGCAG ATTCTGACTGCCCTGATGAGCCTTAGCATGGGAATAACAATGATGTGTATGGCATCTAATACTTATGGAA GTAACCCTATTTCCGTGTATATCGGGTACACAATTTGGGGGTCAGTAATGTTTATTATTTCAGGATCCTT GTCAATTGCAGCAGGAATTAGAACTACAAAAGGCCTGGGTCTGGATGGCATGGTGCTCCTCTTAAGTGTG CTGGAATTCTGCATTGCTGTGTCCCTCTCTGCCTTTGGATGTAAAGTGCTCTGTTGTACCCCTGGTGGGG TTGTGTTAATTCTGCCATCACATTCTCACATGGCAGAAACAGCATCTCCCACACCACTTAATGAGGTTTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243266 |
ORF Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243266.1, NP_001230195.1 |
RefSeq Size | 1509 |
RefSeq ORF | 561 |
Locus ID | 51338 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features, similar intron/exon splice boundaries, and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233387 | MS4A4A (Myc-DDK tagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3 |
USD 420.00 |
|
RG233387 | MS4A4A (GFP-tagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review