MS4A4A (NM_001243266) Human Untagged Clone

CAT#: SC331985

MS4A4A (untagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3


  "NM_001243266" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MS4A4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MS4A4A
Synonyms 4SPAN1; CD20-L1; CD20L1; HDCME31P; MS4A4; MS4A7
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243266, the custom clone sequence may differ by one or more nucleotides


ATGCATCAGACCTACAGCAGACATTGCAGGCCTGAAGAAAGCACCTTTTCTGCTGCCATGACAACCATGC
AAGGAATGGAACAGGCCATGCCAGGGGCTGGCCCTGGTGTGCCCCAGCTGGGAAACATGGCTGTCATACA
TTCACATCTGTGGAAAGGATTGCAAGAGAAGTTCTTGAAGGGAGAACCCAAAGTCCTTGGGGTTGTGCAG
ATTCTGACTGCCCTGATGAGCCTTAGCATGGGAATAACAATGATGTGTATGGCATCTAATACTTATGGAA
GTAACCCTATTTCCGTGTATATCGGGTACACAATTTGGGGGTCAGTAATGTTTATTATTTCAGGATCCTT
GTCAATTGCAGCAGGAATTAGAACTACAAAAGGCCTGGGTCTGGATGGCATGGTGCTCCTCTTAAGTGTG
CTGGAATTCTGCATTGCTGTGTCCCTCTCTGCCTTTGGATGTAAAGTGCTCTGTTGTACCCCTGGTGGGG
TTGTGTTAATTCTGCCATCACATTCTCACATGGCAGAAACAGCATCTCCCACACCACTTAATGAGGTTTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001243266
ORF Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243266.1, NP_001230195.1
RefSeq Size 1509
RefSeq ORF 561
Locus ID 51338
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features, similar intron/exon splice boundaries, and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3) missing an internal protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.