ATPAF1 (NM_001243728) Human Untagged Clone

CAT#: SC332020

ATPAF1 (untagged) - Homo sapiens ATP synthase mitochondrial F1 complex assembly factor 1 (ATPAF1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATPAF1
• Synonyms: ATP11; ATP11p
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243728, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCAGACCCAGCTGCTTTTGAGTCCCGCCTGGAGAAACGCAGTGAATTTCGGAAGCAGCCAGTGGGGC
  ATTCCAGGCAAGGTGATTTTATCAAATGTGTGGAACAGAAGACAGATGCCTTGGGGAAACAGTCTGTGAA
  CAGAGGATTCACTAAGGACAAGACTCTCAGTTCAATCTTTAACATTGAGATGGTAAAAGAAAAAACTGCA
  GAAGAAATAAAACAGATTTGGCAGCAATATTTTGCAGCAAAAGATACAGTCTACGCAGTTATTCCTGCAG
  AAAAGTTTGATTTGATCTGGAACCGGGCTCAGTCCTGTCCAACATTTCTATGTGCTCTGCCAAGAAGGGA
  AGGTTATGAGTTTTTTGTAGGACAATGGACAGGTACTGAACTCCACTTCACTGCACTTATAAATATTCAG
  ACCCGAGGGGAAGCTGCAGCCAGCCAGCTGATTTTATATCACTATCCTGAACTTAAGGAAGAAAAGGGCA
  TAGTGCTGATGACTGCAGAAATGGATTCCACATTTCTGAATGTTGCTGAGGCACAGTGCATCGCCAACCA
  AGTTCAGCTCTTCTACGCTACTGATCGGAAAGAGACCTACGGGTTAGTGGAGACCTTTAACCTCAGACCA
  AATGAGTTCAAATATATGTCTGTCATCGCTGAATTGGAGCAAAGCGGACTTGGAGCAGAACTGAAATGTG
  CCCAGAACCAAAATAAGACTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243728
• ORF Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243728.1, NP_001230657.1
• RefSeq Size: 1710
• RefSeq ORF: 723
• Locus ID: 64756
• Gene Summary: This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.