BID (NM_001244569) Human Untagged Clone
CAT#: SC332074
BID (untagged) - Homo sapiens BH3 interacting domain death agonist (BID), transcript variant 5
"NM_001244569" in other vectors (2)
Product Images
Other products for "BID"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BID |
Synonyms | FP497 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001244569, the custom clone sequence may differ by one or more nucleotides
ATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACCAGCCGGTCGG AGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAGGCCTACCCTAGAGACATGGA GAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTG CTCCGTGATGTCTTTCACACAACAGTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAG CCAGAAATGGGATGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244569 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001244569.1, NP_001231498.1 |
RefSeq Size | 2006 bp |
RefSeq ORF | 300 bp |
Locus ID | 637 |
Cytogenetics | 22q11.21 |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Natural killer cell mediated cytotoxicity, p53 signaling pathway, Pathways in cancer, Viral myocarditis |
Gene Summary | 'This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2, and thus regulate apoptosis. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Aug 2020]' Transcript Variant: This variant (5) has an alternate 5' exon and uses a downstream in-frame start codon, as compared to variant 1. The encoded isoform 3 thus has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.