hHR23b (RAD23B) (NM_001244713) Human Untagged Clone

CAT#: SC332086

RAD23B (untagged) - Homo sapiens RAD23 homolog B (S. cerevisiae) (RAD23B), transcript variant 2


  "NM_001244713" in other vectors (2)

Reconstitution Protocol

USD 390.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAD23B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAD23B
Synonyms HHR23B; HR23B; P58
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001244713, the custom clone sequence may differ by one or more nucleotides


ATGGTGAAAGCACTGAAAGAGAAGATTGAATCTGAAAAGGGGAAAGATGCCTTTCCAGTAGCAGGTCAAA
AATTAATTTATGCAGGCAAAATCCTCAATGATGATACTGCTCTCAAAGAATATAAAATTGATGAGAAAAA
CTTTGTGGTGGTTATGGTGACCAAACCCAAAGCAGTGTCCACACCAGCACCAGCTACAACTCAGCAGTCA
GCTCCTGCCAGCACTACAGCAGTTACTTCCTCCACCACCACAACTGTGGCTCAGGCTCCAACCCCTGTCC
CTGCCTTGGCCCCCACTTCCACACCTGCATCCATCACTCCAGCATCAGCGACAGCATCTTCTGAACCTGC
ACCTGCTAGTGCAGCTAAACAAGAGAAGCCTGCAGAAAAGCCAGCAGAGACACCAGTGGCTACTAGCCCA
ACAGCAACTGACAGTACATCGGGTGATTCTTCTCGGTCAAACCTTTTTGAAGATGCAACGAGTGCACTTG
TGACGGGTCAGTCTTACGAGAATATGGTAACTGAGATCATGTCAATGGGCTATGAACGAGAGCAAGTAAT
TGCAGCCCTGAGAGCCAGTTTCAACAACCCTGACAGAGCAGTGGAGTATCTTTTAATGGGAATCCCTGGA
GATAGAGAAAGTCAGGCTGTGGTTGACCCCCCTCAAGCAGCTAGTACTGGGGCTCCTCAGTCTTCAGCAG
TGGCTGCAGCTGCAGCAACTACGACAGCAACAACTACAACAACAAGTTCTGGAGGACATCCCCTTGAATT
TTTACGGAATCAGCCTCAGTTTCAACAGATGAGACAAATTATTCAGCAGAATCCTTCCTTGCTTCCAGCG
TTACTACAGCAGATAGGTCGAGAGAATCCTCAATTACTTCAGCAAATTAGCCAACACCAGGAGCATTTTA
TTCAGATGTTAAATGAACCAGTTCAAGAAGCTGGTGGTCAAGGAGGAGGAGGTGGAGGTGGCAGTGGAGG
AATTGCAGAAGCTGGAAGTGGTCATATGAACTACATTCAAGTAACACCTCAGGAAAAAGAAGCTATAGAA
AGGTTAAAGGCATTAGGATTTCCTGAAGGACTTGTGATACAAGCGTATTTTGCTTGTGAGAAGAATGAGA
ATTTGGCTGCCAATTTTCTTCTACAGCAGAACTTTGATGAAGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001244713
ORF Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001244713.1, NP_001231642.1
RefSeq Size 3852
RefSeq ORF 1167
Locus ID 5887
Protein Families Druggable Genome
Protein Pathways Nucleotide excision repair
Gene Summary The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) has a distinct 5' UTR and 5' CDS, compared to isoform (1), which results in an isoform (2) with a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.