hHR23b (RAD23B) (NM_001244724) Human Untagged Clone
CAT#: SC332088
RAD23B (untagged) - Homo sapiens RAD23 homolog B (S. cerevisiae) (RAD23B), transcript variant 3
"NM_001244724" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "RAD23B"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAD23B |
Synonyms | HHR23B; HR23B; P58 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001244724, the custom clone sequence may differ by one or more nucleotides
ATGGTGACCAAACCCAAAGCAGTGTCCACACCAGCACCAGCTACAACTCAGCAGTCAGCTCCTGCCAGCA CTACAGCAGTTACTTCCTCCACCACCACAACTGTGGCTCAGGCTCCAACCCCTGTCCCTGCCTTGGCCCC CACTTCCACACCTGCATCCATCACTCCAGCATCAGCGACAGCATCTTCTGAACCTGCACCTGCTAGTGCA GCTAAACAAGAGAAGCCTGCAGAAAAGCCAGCAGAGACACCAGTGGCTACTAGCCCAACAGCAACTGACA GTACATCGGGTGATTCTTCTCGGTCAAACCTTTTTGAAGATGCAACGAGTGCACTTGTGACGGGTCAGTC TTACGAGAATATGGTAACTGAGATCATGTCAATGGGCTATGAACGAGAGCAAGTAATTGCAGCCCTGAGA GCCAGTTTCAACAACCCTGACAGAGCAGTGGAGTATCTTTTAATGGGAATCCCTGGAGATAGAGAAAGTC AGGCTGTGGTTGACCCCCCTCAAGCAGCTAGTACTGGGGCTCCTCAGTCTTCAGCAGTGGCTGCAGCTGC AGCAACTACGACAGCAACAACTACAACAACAAGTTCTGGAGGACATCCCCTTGAATTTTTACGGAATCAG CCTCAGTTTCAACAGATGAGACAAATTATTCAGCAGAATCCTTCCTTGCTTCCAGCGTTACTACAGCAGA TAGGTCGAGAGAATCCTCAATTACTTCAGCAAATTAGCCAACACCAGGAGCATTTTATTCAGATGTTAAA TGAACCAGTTCAAGAAGCTGGTGGTCAAGGAGGAGGAGGTGGAGGTGGCAGTGGAGGAATTGCAGAAGCT GGAAGTGGTCATATGAACTACATTCAAGTAACACCTCAGGAAAAAGAAGCTATAGAAAGGTTAAAGGCAT TAGGATTTCCTGAAGGACTTGTGATACAAGCGTATTTTGCTTGTGAGAAGAATGAGAATTTGGCTGCCAA TTTTCTTCTACAGCAGAACTTTGATGAAGATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244724 |
ORF Size | 1014 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001244724.1, NP_001231653.1 |
RefSeq Size | 3842 |
RefSeq ORF | 1014 |
Locus ID | 5887 |
Protein Families | Druggable Genome |
Protein Pathways | Nucleotide excision repair |
Gene Summary | The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to isoform (1). The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.