SET (NM_001248001) Human Untagged Clone

CAT#: SC332124

SET (untagged) - Homo sapiens SET nuclear oncogene (SET), transcript variant 4


  "NM_001248001" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SET
Synonyms 2PP2A; I2PP2A; IGAAD; IPP2A2; MRD58; PHAPII; TAF-I; TAF-IBETA
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001248001, the custom clone sequence may differ by one or more nucleotides


ATGATGCCTCGCTCCCATCAGCCGCCGCCGCCGCCACATGAAAAAGAACAGCAAGAAGCGATTGAACACA
TTGATGAAGTACAAAATGAAATAGACAGACTTAATGAACAAGCCAGTGAGGAGATTTTGAAAGTAGAACA
GAAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAGGTCAGAATTGATCGCCAAAATCCCAAATTTT
TGGGTAACAACATTTGTCAACCATCCACAAGTGTCTGCACTGCTTGGGGAGGAAGATGAAGAGGCACTGC
ATTATTTGACCAGAGTTGAAGTGACAGAATTTGAAGATATTAAATCAGGTTACAGAATAGATTTTTATTT
TGATGAAAATCCTTACTTTGAAAATAAAGTTCTCTCCAAAGAATTTCATCTGAATGAGAGTGGTGATCCA
TCTTCGAAGTCCACCGAAATCAAATGGAAATCTGGAAAGGATTTGACGAAACGTTCGAGTCAAACGCAGA
ATAAAGCCAGCAGGAAGAGGCAGCATGAGGAACCAGAGAGCTTCTTTACCTGGTTTACTGACCATTCTGA
TGCAGGTGCTGATGAGTTAGGAGAGGTCATCAAAGATGATATTTGGCCAAACCCATTACAGTACTACTTG
GTTCCCGATATGGATGATGAAGAAGGAGAAGGAGAAGAAGATGATGATGATGATGAAGAGGAGGAAGGAT
TAGAAGATATTGACGAAGAAGGGGATGAGGATGAAGGTGAAGAAGATGAAGATGATGATGAAGGGGAGGA
AGGAGAGGAGGATGAAGGAGAAGATGACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001248001
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001248001.1, NP_001234930.1
RefSeq Size 2562 bp
RefSeq ORF 801 bp
Locus ID 6418
Cytogenetics 9q34.11
Protein Families Druggable Genome, Phosphatase, Stem cell - Pluripotency
Gene Summary 'The protein encoded by this gene inhibits acetylation of nucleosomes, especially histone H4, by histone acetylases (HAT). This inhibition is most likely accomplished by masking histone lysines from being acetylated, and the consequence is to silence HAT-dependent transcription. The encoded protein is part of a complex localized to the endoplasmic reticulum but is found in the nucleus and inhibits apoptosis following attack by cytotoxic T lymphocytes. This protein can also enhance DNA replication of the adenovirus genome. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.