USP4 (NM_001251877) Human Untagged Clone

CAT#: SC332140

USP4 (untagged) - Homo sapiens ubiquitin specific peptidase 4 (proto-oncogene) (USP4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: USP4
• Synonyms: UNP; Unph
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001251877, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGAAGGTGGAGGCTGCCGTGAGCGACCGGATGCGGAGACTCAGAAGTCCGAGCTTGGACCCTTAA
  TGAGGACCACACTCCAACGCGGGGCGCAGTGGTATCTTATTGACAGCCGGTGGTTCAAGCAGTGGAAGAA
  GTATGTGGGCTTTGACAGCTGGGACATGTACAATGTGGGTGAACATAACCTATTTCCTGGCCCAATAGAC
  AACTCTGGGCTATTTTCAGATCCTGAGAGTCAGACCTTGAAAGAACACTTAATTGATGAATTGGACTATG
  TATTGGTCCCTACCGAGGCGTGGAATAAACTACTAAACTGGTACGGCTGTGTAGAAGGCCAGCAACCCAT
  CGTCAGAAAAGTTGTGGAGCATGGCCTGTTTGTCAAGCACTGCAAAGTCGAGGTGTATTTGCTGGAACTG
  AAGCTCTGTGAGAACAGTGACCCCACCAATGTGCTGAGTTGCCATTTCAGCAAGGCAGACACCATTGCAA
  CCATCGAGAAAGAGATGCGGAAGCTATTCAACATCCCTGCGGAGCGTGAAACACGGCTCTGGAACAAATA
  CATGAGCAACACCTACGAGCAGTTGAGCAAGCTAGACAACACTGTCCAGGATGCTGGGCTATACCAGGGT
  CAGGTGCTAGTAATTGAGCCTCAAAATGAAGATGGCACATGGCCCAGGCAGACCTTGCAGTCAAAAGTTT
  CGTTCTTTTTGCCCAGGCTGGAGTGCAATGGCGCGATCTTGGCTCACTGCAACTTCTGCCTCCCGGGTTC
  AAGCAATTCTCCTGCCTCAGCTTCCCGAGTAGCGCCATCACATCTGGCTAATTTTTTTTTTTTTGAGATG
  GAGTCTCACTCTGTCACCAAGCTGGAGTGCGGTGGTGCAGTCTCGGCTTACTCCCGGGTTCAAGTGATGC
  TTCTGCCCCAGCCTCCCGAGTGGCTGGGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001251877
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001251877.1, NP_001238806.1
• RefSeq Size: 1673 bp
• RefSeq ORF: 942 bp
• Locus ID: 7375
• Cytogenetics: 3p21.31
• Protein Families: Druggable Genome, Protease
• Gene Summary: 'The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform c, which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.