SLC30A5 (NM_001251969) Human Untagged Clone

CAT#: SC332153

SLC30A5 (untagged) - Homo sapiens solute carrier family 30 (zinc transporter), member 5 (SLC30A5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC30A5
• Synonyms: ZnT-5; ZNT5; ZNTL1; ZTL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001251969, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGAGAAATACGGCGGGGACGTGCTGGCCGGCCCCGGCGGCGGCGGCGGCCTTGGGCCGGTGGACG
  TACCCAGCGCTCGGACTGCATTTTTTATGGTTTTGTTTCAAAAGCCATTTTCTTCTGGGAAAACTATTAC
  CAAACACCAGATAATTGGATCACTAAAAATTCCTGGTAGAAAAGAATTTAAAGACAAAAAGTTAAATGAT
  CCTAGGAAACTAGTGGGAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001251969
• ORF Size: 234 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001251969.1, NP_001238898.1
• RefSeq Size: 1256
• RefSeq ORF: 234
• Locus ID: 64924
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3) lacks an exon in the 5' coding region, differs in the 3' UTR and lacks a large portion of the coding region, compared to variant 1. The encoded isoform (3) is significantly shorter and has a distinct C-terminus, compared to isoform 1.