BBS4 (NM_001252678) Human Untagged Clone
CAT#: SC332212
BBS4 (untagged) - Homo sapiens Bardet-Biedl syndrome 4 (BBS4), transcript variant 2
"NM_001252678" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "BBS4"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BBS4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001252678, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGGAAGATCCACTTGCTGGAGGGAGACTTGGACAAGGCCATTGAAGTCTACAAGAAAGCAGTGG AGTTCTCACCAGAAAATACAGAGCTTCTTACAACTTTAGGATTACTCTACTTACAGCTCGGCATTTACCA GAAGGCATTTGAACATCTTGGCAATGCACTGACTTATGACCCTACCAACTACAAGGCCATCTTGGCAGCA GGCAGCATGATGCAGACCCACGGGGACTTTGATGTTGCCCTCACCAAATACAGAGTTGTGGCTTGTGCTG TTCCAGAAAGTCCTCCACTCTGGAATAACATTGGAATGTGTTTCTTTGGCAAGAAGAAATATGTGGCGGC CATCAGCTGCCTGAAACGAGCCAACTACTTGGCACCCTTCGATTGGAAGATTCTGTATAATTTGGGCCTT GTCCATTTGACCATGCAGCAGTATGCATCAGCTTTTCATTTTCTCAGTGCGGCCATCAACTTCCAGCCAA AGATGGGGGAGCTCTACATGCTCTTGGCAGTGGCTCTGACCAATCTGGAAGATATAGAAAATGCCAAGAG AGCCTACGCAGAAGCAGTCCACCTGGATAAGTGTAACCCTTTAGTAAACCTGAACTATGCTGTGCTGCTG TACAACCAGGGCGAGAAGAAGAACGCCCTGGCCCAATATCAGGAGATGGAGAAGAAAGTCAGCCTACTCA AGGACAATAGCTCTCTGGAATTTGACTCTGAGATGGTGGAGATGGCTCAGAAGTTGGGAGCTGCTCTCCA GGTTGGGGAGGCACTGGTCTGGACCAAACCAGTTAAAGATCCCAAATCAAAGCACCAGACCACTTCAACC AGCAAACCTGCCAGTTTCCAGCAGCCTCTGGGCTCTAATCAAGCTCTAGGACAGGCAATGTCTTCAGCAG CTGCATACAGGACGCTCCCCTCAGGTGCTGGAGGAACATCCCAGTTCACAAAGCCCCCATCTCTTCCTCT GGAGCCAGAGCCTGCGGTGGAATCAAGTCCAACTGAAACATCAGAACAAATAAGAGAGAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252678 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001252678.1, NP_001239607.1 |
RefSeq Size | 2468 bp |
RefSeq ORF | 1044 bp |
Locus ID | 585 |
Cytogenetics | 15q24.1 |
Gene Summary | 'This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and cognitive disability. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]' Transcript Variant: This variant (2) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.