B7H4 (VTCN1) (NM_001253850) Human Untagged Clone

CAT#: SC332242

VTCN1 (untagged) - Homo sapiens V-set domain containing T cell activation inhibitor 1 (VTCN1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VTCN1
• Synonyms: B7-H4; B7h.5; B7H4; B7S1; B7X; PRO1291; VCTN1
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001253850, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCCCTGGGGCAGATCCTCTTCTGGAGCATAATTAGCATCATCATTATTCTGGCTGGAGCAATTG
  CACTCATCATTGGCTTTGGTATTTCAGCCTTCAGCATGCCGGAAGTGAATGTGGACTATAATGCCAGCTC
  AGAGACCTTGCGGTGTGAGGCTCCCCGATGGTTCCCCCAGCCCACAGTGGTCTGGGCATCCCAAGTTGAC
  CAGGGAGCCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGG
  TTGTGTCTGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAA
  AGCAACAGGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCA
  AAGGCTTCTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGA
  TGCTAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253850
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001253850.1, NP_001240779.1
• RefSeq Size: 2304
• RefSeq ORF: 501
• Locus ID: 79679
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 3) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.