COLEC11 (NM_001255982) Human Untagged Clone

CAT#: SC332276

COLEC11 (untagged) - Homo sapiens collectin sub-family member 11 (COLEC11), transcript variant 3


  "NM_001255982" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "COLEC11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol COLEC11
Synonyms 3MC2; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001255982, the custom clone sequence may differ by one or more nucleotides


ATGAGGGGGAATCTGGCCCTGGTGGGCGTTCTAATCAGCCTGGCCTTCCTGTCACTGCTGCCATCTGGAC
ATCCTCAGCCGGCTGGCGATGACGCCTGCTCTGTGCAGATCCTCGTCCCTGGCCTCAAAGGAGACATGGG
GGACAAAGGACAGAAAGGCAGTGTGGGTCGTCATGGAAAAATTGGTCCCATTGGCTCTAAAGGTGAGAAA
GGAGATTCCGGTGACATAGGACCCCCTGGTCCTAATGGAGAACCAGGCCTCCCATGTGAGTGCAGCCAGC
TGCGCAAGGCCATCGGGGAGATGGACAACCAGGTCTCTCAGCTGACCAGCGAGCTCAAGTTCATCAAGAA
TGCTGTCGCCGGTGTGCGCGAGACGGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGCTACGCG
GACGCCCAGCTGTCCTGCCAGGGCCGCGGGGGCACGCTGAGCATGCCCAAGGACGAGGCTGCCAATGGCC
TGATGGCCGCATACCTGGCGCAAGCCGGCCTGGCCCGTGTCTTCATCGGCATCAACGACCTGGAGAAGGA
GGGCGCCTTCGTGTACTCTGACCACTCCCCCATGCGGACCTTCAACAAGTGGCGCAGCGGTGAGCCCAAC
AATGCCTACGACGAGGAGGACTGCGTGGAGATGGTGGCCTCGGGCGGCTGGAACGACGTGGCCTGCCACA
CCACCATGTACTTCATGTGTGAGTTTGACAAGGAGAACATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001255982
ORF Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001255982.1, NP_001242911.1
RefSeq Size 1633
RefSeq ORF 744
Locus ID 78989
Gene Summary This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (c) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.