Glycoprotein VI (GP6) (NM_001256017) Human Untagged Clone
CAT#: SC332283
GP6 (untagged) - Homo sapiens glycoprotein VI (platelet) (GP6), transcript variant 3
"NM_001256017" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "GP6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GP6 |
Synonyms | BDPLT11; GPIV; GPVI |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256017, the custom clone sequence may differ by one or more nucleotides
ATGTCTCCATCCCCGACCGCCCTCTTCTGTCTTGGGCTGTGTCTGGGGCGTGTGCCAGCGCAGAGTGGAC CGCTCCCCAAGCCCTCCCTCCAGGCTCTGCCCAGCTCCCTGGTGCCCCTGGAGAAGCCAGTGACCCTCCG GTGCCAGGGACCTCCGGGCGTGGACCTGTACCGCCTGGAGAAGCTGAGTTCCAGCAGGTACCAGGATCAG GCAGTCCTCTTCATCCCGGCCATGAAGAGAAGTCTGGCTGGACGCTACCGCTGCTCCTACCAGAACGGAA GCCTCTGGTCCCTGCCCAGCGACCAGCTGGAGCTCGTTGCCACGGGAGTTTTTGCCAAACCCTCGCTCTC AGCCCAGCCCGGCCCGGCGGTGTCGTCAGGAGGGGACGTAACCCTACAGTGTCAGACTCGGTATGGCTTT GACCAATTTGCTCTGTACAAGGAAGGGGACCCTGCGCCCTACAAGAATCCCGAGAGATGGTACAGGGCTA GTTTTCCCATCATCACGGTGACCGCCGCCCACAGCGGAACCTACCGATGCTACAGCTTCTCCAGCAGGGA CCCATACCTGTGGTCAGCCCCCAGCGACCCCCTGGAGCTTGTGGTCACAGAATTCTCAGAAGCCACCGCT GAACTGACCGTCTCATTCACAAACGAAGTCTTCACAACTGAGACTTCTAGGAGTATCACCGCCAGTCCAA AGGAGTCAGACTCTCCAGCTGGTCCTGCCCGCCAGTACTACACCAAGGGCAACCTGGTCCGGATATGCCT CGGGGCTGTGATCCTAATAATCCTGGCGGGGTTTCTGGCAGAGGACTGGCACAGCCGGAGGAAGCGCCTG CGGCACAGGGGCAGGGCTGTGCAGAGGCCGCTTCCGCCCCTCCCGCCCCTCCCGCTGACCCGGAAATCAA ACGGGGGTCAGGATGGAGGCCGACAGGATGTTCACAGCCGCGGGTTATGTTCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256017 |
ORF Size | 966 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256017.2, NP_001242946.2 |
RefSeq Size | 2210 |
RefSeq ORF | 966 |
Locus ID | 51206 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | ECM-receptor interaction |
Gene Summary | This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (3) lacks an exon and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 3 which has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.