Glycoprotein VI (GP6) (NM_001256017) Human Untagged Clone

CAT#: SC332283

GP6 (untagged) - Homo sapiens glycoprotein VI (platelet) (GP6), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GP6
• Synonyms: BDPLT11; GPIV; GPVI
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256017, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTCCATCCCCGACCGCCCTCTTCTGTCTTGGGCTGTGTCTGGGGCGTGTGCCAGCGCAGAGTGGAC
  CGCTCCCCAAGCCCTCCCTCCAGGCTCTGCCCAGCTCCCTGGTGCCCCTGGAGAAGCCAGTGACCCTCCG
  GTGCCAGGGACCTCCGGGCGTGGACCTGTACCGCCTGGAGAAGCTGAGTTCCAGCAGGTACCAGGATCAG
  GCAGTCCTCTTCATCCCGGCCATGAAGAGAAGTCTGGCTGGACGCTACCGCTGCTCCTACCAGAACGGAA
  GCCTCTGGTCCCTGCCCAGCGACCAGCTGGAGCTCGTTGCCACGGGAGTTTTTGCCAAACCCTCGCTCTC
  AGCCCAGCCCGGCCCGGCGGTGTCGTCAGGAGGGGACGTAACCCTACAGTGTCAGACTCGGTATGGCTTT
  GACCAATTTGCTCTGTACAAGGAAGGGGACCCTGCGCCCTACAAGAATCCCGAGAGATGGTACAGGGCTA
  GTTTTCCCATCATCACGGTGACCGCCGCCCACAGCGGAACCTACCGATGCTACAGCTTCTCCAGCAGGGA
  CCCATACCTGTGGTCAGCCCCCAGCGACCCCCTGGAGCTTGTGGTCACAGAATTCTCAGAAGCCACCGCT
  GAACTGACCGTCTCATTCACAAACGAAGTCTTCACAACTGAGACTTCTAGGAGTATCACCGCCAGTCCAA
  AGGAGTCAGACTCTCCAGCTGGTCCTGCCCGCCAGTACTACACCAAGGGCAACCTGGTCCGGATATGCCT
  CGGGGCTGTGATCCTAATAATCCTGGCGGGGTTTCTGGCAGAGGACTGGCACAGCCGGAGGAAGCGCCTG
  CGGCACAGGGGCAGGGCTGTGCAGAGGCCGCTTCCGCCCCTCCCGCCCCTCCCGCTGACCCGGAAATCAA
  ACGGGGGTCAGGATGGAGGCCGACAGGATGTTCACAGCCGCGGGTTATGTTCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256017
• ORF Size: 966 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256017.2, NP_001242946.2
• RefSeq Size: 2210
• RefSeq ORF: 966
• Locus ID: 51206
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ECM-receptor interaction
• Gene Summary: This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) lacks an exon and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 3 which has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.