C19orf12 (NM_001256046) Human Untagged Clone

CAT#: SC332291

C19orf12 (untagged) - Homo sapiens chromosome 19 open reading frame 12 (C19orf12), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C19orf12
• Synonyms: MPAN; NBIA3; NBIA4; SPG43
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256046, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTATCATGGTGGAGGACATCATGAAGCTGCTGTGCTCCCTTTCTGGGGAGAGGAAGATGAAGGCGG
  CTGTCAAGCACTCTGGGAAGGGTGCCCTGGTCACAGGGGCCATGGCCTTCGTCGGGGGTTTGGTGGGCGG
  CCCACCGGGACTCGCCGTTGGGGGGGCTGTCGGGGGGCTGTTAGGTGCCTGGATGACAAGTGGACAGTTT
  AAGCCGGTTCCTCAGATCCTAATGGAGCTGCCCCCTGCCGAGCAACAGAGGCTCTTTAACGAAGCCGCAG
  CCATCATCAGGCCCTGCAGCAGCAGCTGCTGGCCATGCTGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256046
• ORF Size: 324 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256046.1, NP_001242975.1
• RefSeq Size: 4628
• RefSeq ORF: 324
• Locus ID: 83636
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a small transmembrane protein. Mutations in this gene are a cause of neurodegeneration with brain iron accumulation-4 (NBIA4), but the specific function of the encoded protein is unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, initiates translation at a downstream, in-frame start codon and uses an alternate splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.