PGAP2 (NM_001256239) Human Untagged Clone

CAT#: SC332323

PGAP2 (untagged) - Homo sapiens post-GPI attachment to proteins 2 (PGAP2), transcript variant 11


  "NM_001256239" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PGAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PGAP2
Synonyms CWH43-N; FRAG1; HPMRS3; MRT17; MRT21
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256239, the custom clone sequence may differ by one or more nucleotides


ATGTACCAGGTCCCACTACCACTGGATCGGGATGGGACCCTGGTACGGCTCCGCTTCACCATGGTGGCCC
TGGTCACGGTCTGCTGTCCACTTGTCGCCTTCCTCTTCTGCATCCTCTGGTCCCTGCTCTTCCACTTCAA
GGAGACAACGGCCACACACTGTGGGGTGCCCAATTACCTGCCCTCGGTGAGCTCAGCCATCGGCGGGGAG
GTGCCCCAGCGCTACGTGTGGCGTTTCTGCATCGGCCTGCACTCGGCGCCTCGCTTCTTGGTGGCCTTCG
CCTACTGGAACCACTACCTCAGCTGCACCTCCCCGTGTTCCTGCTATCGCCCGCTCTGCCGCCTCAACTT
CGGCCTCAATGTCGTGGAGAACCTCGCGTTGCTAGTGCTCACTTATGTCTCCTCCTCCGAGGACTTCACC
ATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGGGCACATGCTCCTCACCTGCATTCTCT
GGCGGTTGACCAAGAAGCACACAGATCGCAAGTCCTACAGCTGGAAACAGCGGCTCTTCATCATCAACTT
CATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTCGGCACAACATGTATTGTGAGGCTGGAGTGTACACC
ATCTTTGCCATCCTGGAGTACACTGTTGTCTTAACCAACATGGCGTTCCACATGACGGCCTGGTGGGACT
TCGGGAACAAGGAGCTGCTCATAACCTCTCAGCCTGAGGAAAAGCGATTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256239
ORF Size 753 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256239.1, NP_001243168.1
RefSeq Size 1806
RefSeq ORF 753
Locus ID 27315
Protein Families Druggable Genome, Transmembrane
Gene Summary The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (11) lacks an alternate in-frame exon in the 5' coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (7) is shorter than isoform 1. Variants 11 and 27 both encode the same isoform (7).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations[BizGenius]

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.