ATPAF1 (NM_001256418) Human Untagged Clone

CAT#: SC332377

ATPAF1 (untagged) - Homo sapiens ATP synthase mitochondrial F1 complex assembly factor 1 (ATPAF1), transcript variant 4


  "NM_001256418" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATPAF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATPAF1
Synonyms ATP11; ATP11p
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256418, the custom clone sequence may differ by one or more nucleotides


ATGGTAAAAGAAAAAACTGCAGAAGAAATAAAACAGATTTGGCAGCAATATTTTGCAGCAAAAGATACAG
TCTACGCAGTTATTCCTGCAGAAAAGTTTGATTTGATCTGGAACCGGGCTCAGTCCTGTCCAACATTTCT
ATGTGCTCTGCCAAGAAGGGAAGGTTATGAGTTTTTTGTAGGACAATGGACAGGTACTGAACTCCACTTC
ACTGCACTTATAAATATTCAGACCCGAGGGGAAGCTGCAGCCAGCCAGCTGATTTTATATCACTATCCTG
AACTTAAGGAAGAAAAGGGCATAGTGCTGATGACTGCAGAAATGGATTCCACATTTCTGAATGTTGCTGA
GGCACAGTGCATCGCCAACCAAGTTCAGCTCTTCTACGCTACTGATCGGAAAGAGACCTACGGGTTAGTG
GAGACCTTTAACCTCAGACCAAATGAGTTCAAATATATGTCTGTCATCGCTGAATTGGAGCAAAGCGGAC
TTGGAGCAGAACTGAAATGTGCCCAGAACCAAAATAAGACTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001256418
ORF Size 534 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256418.1, NP_001243347.1
RefSeq Size 1801
RefSeq ORF 534
Locus ID 64756
Gene Summary This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.