Cell adhesion molecule 2 (CADM2) (NM_001256503) Human Untagged Clone

CAT#: SC332403

CADM2 (untagged) - Homo sapiens cell adhesion molecule 2 (CADM2), transcript variant 5


  "NM_001256503" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CADM2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CADM2
Synonyms IGSF4D; Necl-3; NECL3; SynCAM 2; synCAM2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256503, the custom clone sequence may differ by one or more nucleotides


ATGCCTGTCAAAACTTCCAAGGCATATCTCACCGTTCTGGGTGTTCCTGAAAAGCCTCAGATTAGTGGAT
TCTCATCACCAGTTATGGAGGGTGACTTGATGCAGCTGACTTGCAAAACATCTGGTAGTAAACCTGCAGC
TGATATAAGATGGTTCAAAAATGACAAAGAGATTAAAGATGTAAAATATTTAAAAGAAGAGGATGCAAAT
CGCAAGACATTCACTGTCAGCAGCACACTGGACTTCCGAGTGGACCGGAGTGATGATGGAGTGGCGGTCA
TCTGCAGAGTAGATCACGAATCCCTCAATGCCACCCCTCAGGTAGCCATGCAGGTGCTAGAAATACACTA
TACACCATCAGTTAAGATTATACCATCGACTCCTTTTCCACAAGAAGGACAGCCTTTAATTTTGACTTGT
GAATCCAAAGGAAAACCACTGCCAGAACCTGTTTTGTGGACAAAGGATGGCGGAGAATTACCAGATCCTG
ACCGAATGGTTGTGAGTGGTAGGGAGCTAAACATTCTTTTCCTGAACAAAACGGATAATGGTACATATCG
ATGTGAAGCCACAAACACCATTGGCCAAAGCAGTGCGGAATATGTTCTCATTGTGCATGATGTTCCCAAC
ACTTTGCTTCCCACTACTATCATCCCCTCCCTTACCACTGCAACAGTCACAACCACTGTAGCCATAACAA
CCAGCCCAACCACATCTGCAACAACCAGCAGCATCAGAGATCCTAATGCTTTGGCTGGCCAGAATGGCCC
TGACCATGCTCTCATAGGAGGAATAGTGGCTGTAGTTGTATTTGTCACGCTGTGTTCTATCTTTCTGCTT
GGTCGATATCTGGCAAGGCATAAAGGAACGTATTTAACAAATGAAGCTAAAGGAGCTGAAGATGCACCAG
ATGCTGATACAGCCATTATCAATGCTGAAGGCAGCCAAGTCAATGCTGAAGAGAAAAAAGAGTATTTCAT
TTAA


Restriction Sites SgfI-MluI     
ACCN NM_001256503
ORF Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256503.1, NP_001243432.1
RefSeq Size 8977
RefSeq ORF 984
Locus ID 253559
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (5) differs in the 5' UTR and coding region and uses a downstream start codon compared to variant 1. The resulting protein (isoform 4) is shorter and has a shorter N-terminus compared to isoform 1. Variants 4 and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.