Cell adhesion molecule 2 (CADM2) (NM_001256504) Human Untagged Clone
CAT#: SC332404
CADM2 (untagged) - Homo sapiens cell adhesion molecule 2 (CADM2), transcript variant 6
"NM_001256504" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "CADM2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CADM2 |
Synonyms | IGSF4D; Necl-3; NECL3; SynCAM 2; synCAM2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256504, the custom clone sequence may differ by one or more nucleotides
ATGCCTGTCAAAACTTCCAAGGCATATCTCACCGTTCTGGGTGTTCCTGAAAAGCCTCAGATTAGTGGAT TCTCATCACCAGTTATGGAGGGTGACTTGATGCAGCTGACTTGCAAAACATCTGGTAGTAAACCTGCAGC TGATATAAGATGGTTCAAAAATGACAAAGAGATTAAAGATGTAAAATATTTAAAAGAAGAGGATGCAAAT CGCAAGACATTCACTGTCAGCAGCACACTGGACTTCCGAGTGGACCGGAGTGATGATGGAGTGGCGGTCA TCTGCAGAGTAGATCACGAATCCCTCAATGCCACCCCTCAGGTAGCCATGCAGGTGCTAGAAATACACTA TACACCATCAGTTAAGATTATACCATCGACTCCTTTTCCACAAGAAGGACAGCCTTTAATTTTGACTTGT GAATCCAAAGGAAAACCACTGCCAGAACCTGTTTTGTGGACAAAGGATGGCGGAGAATTACCAGATCCTG ACCGAATGGTTGTGAGTGGTAGGGAGCTAAACATTCTTTTCCTGAACAAAACGGATAATGGTACATATCG ATGTGAAGCCACAAACACCATTGGCCAAAGCAGTGCGGAATATGTTCTCATTGTGCATGATCCTAATGCT TTGGCTGGCCAGAATGGCCCTGACCATGCTCTCATAGGAGGAATAGTGGCTGTAGTTGTATTTGTCACGC TGTGTTCTATCTTTCTGCTTGGTCGATATCTGGCAAGGCATAAAGGAACGTATTTAACAAATGAAGCTAA AGGAGCTGAAGATGCACCAGATGCTGATACAGCCATTATCAATGCTGAAGGCAGCCAAGTCAATGCTGAA GAGAAAAAAGAGTATTTCATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256504 |
ORF Size | 864 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256504.1, NP_001243433.1 |
RefSeq Size | 9034 |
RefSeq ORF | 864 |
Locus ID | 253559 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (6) differs in the 5' UTR and coding region, lacks an alternate in-frame exon in the 3' CDS and uses a downstream start codon compared to variant 1. The resulting protein (isoform 5) is shorter and has a shorter N-terminus compared to isoform 1. Variants 6 and 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.